Stem-loop sequence mmu-mir-145a

AccessionMI0000169 (change log)
Previous IDsmmu-mir-145
Symbol MGI:Mir145a
DescriptionMus musculus miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

217 open access papers mention mmu-mir-145a
(1841 sentences)

Stem-loop
       c  uc    u  c            uggau 
5' cuca gg  cagu uu ccaggaaucccu     g
   |||| ||  |||| || ||||||||||||     c
3' gagu uc  guca aa gguccuuagggg     u
       -  uu    u  a            uagaa 
Get sequence
Deep sequencing
508298 reads, 1.33e+03 reads per million, 90 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 61647825-61647894 [-]
sense
ENSMUST00000083658 ; Mir145-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-145a
mmu-mir-143chr18: 61649196-61649258 [-]
mmu-mir-145achr18: 61647825-61647894 [-]
Database links

Mature sequence mmu-miR-145a-5p

Accession MIMAT0000157
Previous IDsmmu-miR-145;mmu-miR-145-5p
Sequence

7 - 

guccaguuuucccaggaaucccu

 - 29

Get sequence
Deep sequencing421607 reads, 89 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-145a-3p

Accession MIMAT0004534
Previous IDsmmu-miR-145*;mmu-miR-145-3p
Sequence

47 - 

auuccuggaaauacuguucuug

 - 68

Get sequence
Deep sequencing85302 reads, 79 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).