Stem-loop sequence mmu-mir-145a

AccessionMI0000169 (change log)
Previous IDsmmu-mir-145
Symbol MGI:Mir145a
DescriptionMus musculus miR-145 stem-loop
Gene family MIPF0000079; mir-145
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-145. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-145 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       c  uc    u  c            uggau 
5' cuca gg  cagu uu ccaggaaucccu     g
   |||| ||  |||| || ||||||||||||     c
3' gagu uc  guca aa gguccuuagggg     u
       -  uu    u  a            uagaa 
Get sequence
Deep sequencing
41654 reads, 747 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 61647825-61647894 [-]
sense
ENSMUST00000083658 ; Mir145-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-145a
mmu-mir-143chr18: 61649196-61649258 [-]
mmu-mir-145achr18: 61647825-61647894 [-]
Database links

Mature sequence mmu-miR-145a-5p

Accession MIMAT0000157
Previous IDsmmu-miR-145;mmu-miR-145-5p
Sequence

7 - 

guccaguuuucccaggaaucccu

 - 29

Get sequence
Deep sequencing37839 reads, 59 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-145a-3p

Accession MIMAT0004534
Previous IDsmmu-miR-145*;mmu-miR-145-3p
Sequence

47 - 

auuccuggaaauacuguucuug

 - 68

Get sequence
Deep sequencing3497 reads, 48 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).