Stem-loop sequence mmu-mir-144

AccessionMI0000168
Symbol MGI:Mir144
DescriptionMus musculus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-144. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-144 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. In humans, miR-144 has been characterised as a "common miRNA signature" of a number of different tumours. GATA4 is thought to activate transcription of the miR-144 microRNA precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         g        a         -a    gu 
5' ggcugg auaucauc uauacugua  guuu  g
   |||||| |||||||| |||||||||  ||||   
3' cugauc uguaguag auaugacau  caga  a
         a        -         ca    gu 
Get sequence
Deep sequencing
132400 reads, 1.61e+03 reads per million, 87 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 78073005-78073070 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-144
mmu-mir-144chr11: 78073005-78073070 [+]
mmu-mir-451bchr11: 78073170-78073241 [-]
mmu-mir-451achr11: 78073170-78073241 [+]
Database links

Mature sequence mmu-miR-144-5p

Accession MIMAT0016988
Previous IDsmmu-miR-144*
Sequence

6 - 

ggauaucaucauauacuguaagu

 - 28

Get sequence
Deep sequencing3427 reads, 62 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence mmu-miR-144-3p

Accession MIMAT0000156
Previous IDsmmu-miR-144
Sequence

43 - 

uacaguauagaugauguacu

 - 62

Get sequence
Deep sequencing86143 reads, 53 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).