Stem-loop sequence mmu-mir-144

AccessionMI0000168 (change log)
Symbol MGI:Mir144
DescriptionMus musculus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

69 open access papers mention mmu-mir-144
(918 sentences)

Stem-loop
         g        a         -a    gu 
5' ggcugg auaucauc uauacugua  guuu  g
   |||||| |||||||| |||||||||  ||||   
3' cugauc uguaguag auaugacau  caga  a
         a        -         ca    gu 
Get sequence
Deep sequencing
235310 reads, 987 reads per million, 89 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 78073005-78073070 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-144
mmu-mir-144chr11: 78073005-78073070 [+]
mmu-mir-451bchr11: 78073170-78073241 [-]
mmu-mir-451achr11: 78073170-78073241 [+]
Database links

Mature sequence mmu-miR-144-5p

Accession MIMAT0016988
Previous IDsmmu-miR-144*
Sequence

6 - 

ggauaucaucauauacuguaagu

 - 28

Get sequence
Deep sequencing89431 reads, 78 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-144-3p

Accession MIMAT0000156
Previous IDsmmu-miR-144
Sequence

43 - 

uacaguauagaugauguacu

 - 62

Get sequence
Deep sequencing145766 reads, 67 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).