Stem-loop sequence mmu-mir-142a

AccessionMI0000167
Previous IDsmmu-mir-142
Symbol MGI:Mir142
DescriptionMus musculus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   -ac           a         uaa ag a 
5'    ccauaaaguag aagcacuac   c  c c
      ||||||||||| |||||||||   |  |  
3'    gguauuucauc uuugugaug   g  g u
   gua           c         -ug ga g 
Get sequence
Deep sequencing
1826217 reads, 7.16e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Expression of miRNAs from both 5' and 3' arms of this precursor have been independently verified in the mouse gut tissue [1] and in embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 87756864-87756927 [+]
sense
OTTMUST00000002656 ; RP23-449P23.3-001; intron 1
ENSMUST00000123700 ; A430104N18Rik-001; intron 1
antisense
ENSMUST00000083486 ; Mir142-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-142a
mmu-mir-142bchr11: 87756841-87756955 [-]
mmu-mir-142achr11: 87756864-87756927 [+]
Database links

Mature sequence mmu-miR-142a-5p

Accession MIMAT0000154
Previous IDsmmu-miR-142-5p
Sequence

4 - 

cauaaaguagaaagcacuacu

 - 24

Get sequence
Deep sequencing1631569 reads, 83 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Predicted targets

Mature sequence mmu-miR-142a-3p

Accession MIMAT0000155
Previous IDsmmu-miR-142-3p
Sequence

40 - 

uguaguguuuccuacuuuaugga

 - 62

Get sequence
Deep sequencing127381 reads, 91 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).