Stem-loop sequence mmu-mir-141

AccessionMI0000166 (change log)
Symbol MGI:Mir141
DescriptionMus musculus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

128 open access papers mention mmu-mir-141
(1109 sentences)

Stem-loop
      u       --    u          au    gaa 
5' ggg ccaucuu  ccag gcaguguugg  gguu   g
   ||| |||||||  |||| ||||||||||  ||||   u
3' ccc gguagaa  gguc ugucacaauc  ucga   a
      -       au    -          -c    agu 
Get sequence
Deep sequencing
191453 reads, 933 reads per million, 99 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 124717914-124717985 [-]
sense
OTTMUST00000067268 ; RP24-297C1.9-001; intron 1
ENSMUST00000143765 ; Gm15884-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-141
mmu-mir-200cchr6: 124718322-124718390 [-]
mmu-mir-141chr6: 124717914-124717985 [-]
Database links

Mature sequence mmu-miR-141-5p

Accession MIMAT0004533
Previous IDsmmu-miR-141*
Sequence

6 - 

caucuuccagugcaguguugga

 - 27

Get sequence
Deep sequencing1032 reads, 57 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-141-3p

Accession MIMAT0000153
Previous IDsmmu-miR-141
Sequence

48 - 

uaacacugucugguaaagaugg

 - 69

Get sequence
Deep sequencing190380 reads, 99 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).