Stem-loop sequence mmu-mir-141

Accession MI0000166
Symbol MGI:Mir141
Description Mus musculus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u       --    u          au    gaa 
ggg ccaucuu  ccag gcaguguugg  gguu   g
||| |||||||  |||| ||||||||||  ||||   u
ccc gguagaa  gguc ugucacaauc  ucga   a
   -       au    -          -c    agu 
Get sequence
Deep sequencing
62412 reads, 95 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr6: 124717914-124717985 [-]
sense
OTTMUST00000067268 ; RP24-297C1.9-001; intron 1
ENSMUST00000143765 ; Gm15884-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-141
mmu-mir-200c chr6: 124718322-124718390 [-]
mmu-mir-141 chr6: 124717914-124717985 [-]
Database links

Mature sequence mmu-miR-141-5p

Accession MIMAT0004533
Previous IDs mmu-miR-141*
Sequence

6 - 

caucuuccagugcaguguugga

 - 27

Get sequence
Deep sequencing 1185 reads, 55 experiments
Evidence experimental; cloned [4], Solexa [5-6]
Predicted targets

Mature sequence mmu-miR-141-3p

Accession MIMAT0000153
Previous IDs mmu-miR-141
Sequence

48 - 

uaacacugucugguaaagaugg

 - 69

Get sequence
Deep sequencing 57513 reads, 80 experiments
Evidence experimental; cloned [1,3-4], Solexa [5-6]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).