Stem-loop sequence mmu-mir-140

Accession MI0000165
Symbol MGI:Mir140
Description Mus musculus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
    -  a             a       uu   uc 
ccug cc gugguuuuacccu ugguagg  acg  a
|||| || ||||||||||||| |||||||  |||   
ggac gg caccaagauggga accaucu  ugu  u
    a  -             c       --   cg 
Get sequence
Deep sequencing
6918207 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 107551244-107551313 [+]
sense
ENSMUST00000166615 ; Wwp2-201; intron 16
Database links

Mature sequence mmu-miR-140-5p

Accession MIMAT0000151
Previous IDs mmu-miR-140
Sequence

6 - 

cagugguuuuacccuaugguag

 - 27

Get sequence
Deep sequencing 92372 reads, 82 experiments
Evidence experimental; cloned [1-4], Solexa [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-140-3p

Accession MIMAT0000152
Previous IDs mmu-miR-140*
Sequence

45 - 

uaccacaggguagaaccacgg

 - 65

Get sequence
Deep sequencing 6750005 reads, 82 experiments
Evidence experimental; cloned [2,4], Solexa [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).