Stem-loop sequence mmu-mir-140

AccessionMI0000165
Symbol MGI:Mir140
DescriptionMus musculus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
       -  a             a       uu   uc 
5' ccug cc gugguuuuacccu ugguagg  acg  a
   |||| || ||||||||||||| |||||||  |||   
3' ggac gg caccaagauggga accaucu  ugu  u
       a  -             c       --   cg 
Get sequence
Deep sequencing
7159760 reads, 2.21e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 107551244-107551313 [+]
sense
ENSMUST00000166615 ; Wwp2-201; intron 16
Database links

Mature sequence mmu-miR-140-5p

Accession MIMAT0000151
Previous IDsmmu-miR-140
Sequence

6 - 

cagugguuuuacccuaugguag

 - 27

Get sequence
Deep sequencing69974 reads, 88 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-140-3p

Accession MIMAT0000152
Previous IDsmmu-miR-140*
Sequence

45 - 

uaccacaggguagaaccacgg

 - 65

Get sequence
Deep sequencing6713984 reads, 93 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).