Stem-loop sequence mmu-mir-137

AccessionMI0000163 (change log)
Symbol MGI:Mir137
DescriptionMus musculus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

63 open access papers mention mmu-mir-137
(581 sentences)

Stem-loop
         ug   g           ug a     -  g 
5' cuucgg  acg guauucuuggg  g uaaua cg a
   ||||||  ||| |||||||||||  | ||||| || u
3' ggagcu  ugc cauaagaauuc  u auugu gc u
         ga   g           gu -     u  a 
Get sequence
Deep sequencing
98840 reads, 669 reads per million, 42 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 118433857-118433929 [+]
sense
OTTMUST00000112490 ; RP23-14P23.2-002; exon 1
OTTMUST00000112491 ; RP23-14P23.2-003; exon 1
OTTMUST00000112489 ; RP23-14P23.2-005; exon 3
ENSMUST00000180593 ; Gm26871-002; exon 1
ENSMUST00000181926 ; Gm26871-003; exon 1
ENSMUST00000083635 ; Mir137-201; exon 1
ENSMUST00000180774 ; Gm26871-005; exon 3
Database links

Mature sequence mmu-miR-137-5p

Accession MIMAT0016986
Previous IDsmmu-miR-137*
Sequence

9 - 

acggguauucuuggguggauaau

 - 31

Get sequence
Deep sequencing225 reads, 17 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-137-3p

Accession MIMAT0000149
Previous IDsmmu-miR-137
Sequence

45 - 

uuauugcuuaagaauacgcguag

 - 67

Get sequence
Deep sequencing98612 reads, 41 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).