Stem-loop sequence mmu-mir-137

AccessionMI0000163
Symbol MGI:Mir137
DescriptionMus musculus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. Recent genome-wide association studies (GWAS) have provided evidence to suggest that single nucleotide polymorphisms in the vicinity of the MIR137 gene are statistically associated with schizophrenia and other psychiatric disorders. miR-137 is shown to regulate neural stem cell proliferation and differentiation in mouse embryonic stem cells, and neuronal maturation, including regulation of dendrite length, branch points, end points, and spine density in mouse adult hippocampal neuroprogenitor-derived and mouse fetal hippocampus neurons. Decreased spine density has also been observed in the dorsolateral cortex of patients with schizophrenia. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         ug   g           ug a     -  g 
5' cuucgg  acg guauucuuggg  g uaaua cg a
   ||||||  ||| |||||||||||  | ||||| || u
3' ggagcu  ugc cauaagaauuc  u auugu gc u
         ga   g           gu -     u  a 
Get sequence
Deep sequencing
197283 reads, 1.33e+03 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr3: 118433857-118433929 [+]
sense
OTTMUST00000112490 ; RP23-14P23.2-002; exon 1
OTTMUST00000112491 ; RP23-14P23.2-003; exon 1
OTTMUST00000112489 ; RP23-14P23.2-005; exon 3
ENSMUST00000180593 ; Gm26871-002; exon 1
ENSMUST00000181926 ; Gm26871-003; exon 1
ENSMUST00000083635 ; Mir137-201; exon 1
ENSMUST00000180774 ; Gm26871-005; exon 3
Database links

Mature sequence mmu-miR-137-5p

Accession MIMAT0016986
Previous IDsmmu-miR-137*
Sequence

9 - 

acggguauucuuggguggauaau

 - 31

Get sequence
Deep sequencing192 reads, 17 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence mmu-miR-137-3p

Accession MIMAT0000149
Previous IDsmmu-miR-137
Sequence

45 - 

uuauugcuuaagaauacgcguag

 - 67

Get sequence
Deep sequencing73390 reads, 37 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).