Stem-loop sequence mmu-mir-135a-1

Accession

MI0000161

Previous IDs

mmu-mir-135;mmu-mir-135-1

Symbol

MGI:Mirn135a-1

Description

Mus musculus miR-135a-1 stem-loop

Gene family

MIPF0000028; mir-135

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

agg         u u          uu            uucua 
   ccucacugu c cuauggcuuu  auuccuauguga     u
   ||||||||| | ||||||||||  ||||||||||||     u
   ggaguggca g ggugccgagg  uagggauauacu     g
aua         u c          -u            cgcuc 

Deep sequencing

205013 reads, 80 experiments

Genome context

• Coordinates (GRCm38): chr9: 106154124-106154213 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000088120 ; RP23-441D9.4-001; intron 4

  ENSMUST00000143956 ; D030055H07Rik-001; intron 4

  antisense

  OTTMUST00000088124 ; Glyctk-002; 3'UTR (exon 4)

  OTTMUST00000088123 ; Glyctk-001; 3'UTR (exon 5)

  ENSMUST00000036382 ; Glyctk-002; 3'UTR (exon 4)

  ENSMUST00000112543 ; Glyctk-001; 3'UTR (exon 5)

Database links

• EMBL: AJ459746;MMU459746
• ENTREZGENE: 387153;Mir135a-1
• MGI: 2676820;Mirn135a-1

Mature sequence mmu-miR-135a-5p

• Accession: MIMAT0000147
• Previous IDs: mmu-miR-135a
• Sequence: 17 - uauggcuuuuuauuccuauguga - 39
• Deep sequencing: 380933 reads, 58 experiments
• Evidence: experimental; cloned [1,3], Solexa [4-5]
• Validated targets:
  • TARBASE:mmu-miR-135a-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-135a-5p
  • MICRORNA.ORG:mmu-miR-135a-5p
  • MIRDB:mmu-miR-135a-5p
  • RNA22-MMU:mmu-miR-135a-5p
  • TARGETSCAN-VERT:mmu-miR-135a

Mature sequence mmu-miR-135a-1-3p

• Accession: MIMAT0004531
• Previous IDs: mmu-miR-135a*;mmu-miR-135a-1*
• Sequence: 56 - uauagggauuggagccguggcg - 77
• Deep sequencing: 2638 reads, 40 experiments
• Evidence: experimental; cloned [3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-135a-1-3p
  • MICRORNA.ORG:mmu-miR-135a-1-3p
  • MIRDB:mmu-miR-135a-1-3p
  • RNA22-MMU:mmu-miR-135a-1-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).