Stem-loop sequence mmu-mir-135a-1

AccessionMI0000161
Previous IDsmmu-mir-135;mmu-mir-135-1
Symbol MGI:Mirn135a-1
DescriptionMus musculus miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   agg         u u          uu            uucua 
5'    ccucacugu c cuauggcuuu  auuccuauguga     u
      ||||||||| | ||||||||||  ||||||||||||     u
3'    ggaguggca g ggugccgagg  uagggauauacu     g
   aua         u c          -u            cgcuc 
Get sequence
Deep sequencing
209263 reads, 3.24e+03 reads per million, 93 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 106154124-106154213 [+]
sense
OTTMUST00000088120 ; RP23-441D9.4-001; intron 4
ENSMUST00000143956 ; D030055H07Rik-001; intron 4
antisense
OTTMUST00000088124 ; Glyctk-002; 3'UTR (exon 4)
OTTMUST00000088123 ; Glyctk-001; 3'UTR (exon 5)
ENSMUST00000036382 ; Glyctk-002; 3'UTR (exon 4)
ENSMUST00000112543 ; Glyctk-001; 3'UTR (exon 5)
Database links

Mature sequence mmu-miR-135a-5p

Accession MIMAT0000147
Previous IDsmmu-miR-135a
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing233176 reads, 62 experiments
Evidence experimental; cloned [1,3], Illumina [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-135a-1-3p

Accession MIMAT0004531
Previous IDsmmu-miR-135a*;mmu-miR-135a-1*
Sequence

56 - 

uauagggauuggagccguggcg

 - 77

Get sequence
Deep sequencing2503 reads, 39 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).