Stem-loop sequence mmu-mir-135a-1

AccessionMI0000161 (change log)
Previous IDsmmu-mir-135;mmu-mir-135-1
Symbol MGI:Mir135a-1
DescriptionMus musculus miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Literature search

73 open access papers mention mmu-mir-135a-1
(507 sentences)

Stem-loop
   agg         u u          uu            uucua 
5'    ccucacugu c cuauggcuuu  auuccuauguga     u
      ||||||||| | ||||||||||  ||||||||||||     u
3'    ggaguggca g ggugccgagg  uagggauauacu     g
   aua         u c          -u            cgcuc 
Get sequence
Deep sequencing
188207 reads, 1.61e+03 reads per million, 85 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 106154124-106154213 [+]
sense
OTTMUST00000088120 ; RP23-441D9.4-001; intron 4
ENSMUST00000143956 ; D030055H07Rik-001; intron 4
antisense
OTTMUST00000088124 ; Glyctk-002; 3'UTR (exon 4)
OTTMUST00000088123 ; Glyctk-001; 3'UTR (exon 5)
ENSMUST00000036382 ; Glyctk-002; 3'UTR (exon 4)
ENSMUST00000112543 ; Glyctk-001; 3'UTR (exon 5)
Database links

Mature sequence mmu-miR-135a-5p

Accession MIMAT0000147
Previous IDsmmu-miR-135a
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing365449 reads, 76 experiments
Evidence experimental; cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-135a-1-3p

Accession MIMAT0004531
Previous IDsmmu-miR-135a*;mmu-miR-135a-1*
Sequence

56 - 

uauagggauuggagccguggcg

 - 77

Get sequence
Deep sequencing3321 reads, 43 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).