Stem-loop sequence mmu-mir-134

AccessionMI0000160
Symbol MGI:Mir134
DescriptionMus musculus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        gu        u  -a   g    gcgu  a 
5' agggu  gugacugg ug  cca aggg    gc c
   |||||  |||||||| ||  ||| ||||    || u
3' uccca  cacugauc ac  ggu uccc    ug c
        ac        c  cg   g    -acu  u 
Get sequence
Deep sequencing
64053 reads, 557 reads per million, 86 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109734139-109734209 [+]
sense
OTTMUST00000114051 ; Mirg-010; exon 4
OTTMUST00000114052 ; Mirg-009; exon 5
OTTMUST00000114049 ; Mirg-011; exon 8
ENSMUST00000083492 ; Mir134-201; exon 1
ENSMUST00000182185 ; Mirg-010; exon 4
ENSMUST00000182499 ; Mirg-009; exon 5
ENSMUST00000183144 ; Mirg-011; exon 8
Clustered miRNAs
< 10kb from mmu-mir-134
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
Database links

Mature sequence mmu-miR-134-5p

Accession MIMAT0000146
Previous IDsmmu-miR-134
Sequence

7 - 

ugugacugguugaccagagggg

 - 28

Get sequence
Deep sequencing46407 reads, 76 experiments
Evidence experimental; cloned [1,3-4], PCR [2], Illumina [5,7]
Validated targets
Predicted targets

Mature sequence mmu-miR-134-3p

Accession MIMAT0016985
Previous IDsmmu-miR-134*
Sequence

46 - 

cugugggccaccuagucacc

 - 65

Get sequence
Deep sequencing227 reads, 25 experiments
Evidence experimental; 454 [6], Illumina [7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).