Stem-loop sequence mmu-mir-134

Accession MI0000160
Symbol MGI:Mir134
Description Mus musculus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     gu        u  -a   g    gcgu  a 
agggu  gugacugg ug  cca aggg    gc c
|||||  |||||||| ||  ||| ||||    || u
uccca  cacugauc ac  ggu uccc    ug c
     ac        c  cg   g    -acu  u 
Get sequence
Deep sequencing
55221 reads, 75 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109734139-109734209 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-134
mmu-mir-300 chr12: 109724313-109724391 [+]
mmu-mir-381 chr12: 109726822-109726896 [+]
mmu-mir-487b chr12: 109727333-109727414 [+]
mmu-mir-539 chr12: 109728129-109728202 [+]
mmu-mir-544 chr12: 109729325-109729402 [+]
mmu-mir-382 chr12: 109733771-109733846 [+]
mmu-mir-134 chr12: 109734139-109734209 [+]
mmu-mir-668 chr12: 109734732-109734797 [+]
mmu-mir-485 chr12: 109734902-109734974 [+]
mmu-mir-453 chr12: 109735619-109735700 [+]
mmu-mir-154 chr12: 109738433-109738498 [+]
mmu-mir-496a chr12: 109739119-109739197 [+]
mmu-mir-377 chr12: 109740510-109740577 [+]
mmu-mir-541 chr12: 109742409-109742498 [+]
mmu-mir-409 chr12: 109743158-109743236 [+]
mmu-mir-412 chr12: 109743289-109743368 [+]
mmu-mir-369 chr12: 109743418-109743496 [+]
mmu-mir-410 chr12: 109743715-109743795 [+]
Database links

Mature sequence mmu-miR-134-5p

Accession MIMAT0000146
Previous IDs mmu-miR-134
Sequence

7 - 

ugugacugguugaccagagggg

 - 28

Get sequence
Deep sequencing 54873 reads, 69 experiments
Evidence experimental; cloned [1,3-4], PCR [2], Solexa [5,7]
Validated targets
Predicted targets

Mature sequence mmu-miR-134-3p

Accession MIMAT0016985
Previous IDs mmu-miR-134*
Sequence

46 - 

cugugggccaccuagucacc

 - 65

Get sequence
Deep sequencing 290 reads, 26 experiments
Evidence experimental; 454 [6], Solexa [7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).