Stem-loop sequence mmu-mir-132

AccessionMI0000158 (change log)
Symbol MGI:Mir132
DescriptionMus musculus miR-132 stem-loop
Gene family MIPF0000065; mir-132
Literature search

178 open access papers mention mmu-mir-132
(1841 sentences)

Stem-loop
       a         uuc          -g     
5' gggc accguggcu   gauuguuacu  uggg 
   |||| |||||||||   ||||||||||  ||| a
3' cccg ugguaccga   cugacaaugg  gcca 
       c         cau          ag     
Get sequence
Deep sequencing
157834 reads, 129 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 75173682-75173747 [+]
sense
OTTMUST00000013960 ; RP23-143A14.3-001; intron 1
ENSMUST00000134252 ; 1700016P03Rik-001; intron 1
ENSMUST00000083603 ; Mir132-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-132
mmu-mir-212chr11: 75173388-75173478 [+]
mmu-mir-132chr11: 75173682-75173747 [+]
Database links

Mature sequence mmu-miR-132-5p

Accession MIMAT0016984
Previous IDsmmu-miR-132*
Sequence

5 - 

aaccguggcuuucgauuguuac

 - 26

Get sequence
Deep sequencing10315 reads, 89 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-132-3p

Accession MIMAT0000144
Previous IDsmmu-miR-132
Sequence

42 - 

uaacagucuacagccauggucg

 - 63

Get sequence
Deep sequencing147423 reads, 105 experiments
Evidence experimental; cloned [1-2], Illumina [3,5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).