Stem-loop sequence mmu-mir-132

AccessionMI0000158
Symbol MGI:Mir132
DescriptionMus musculus miR-132 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       a         uuc          -g     
5' gggc accguggcu   gauuguuacu  uggg 
   |||| |||||||||   ||||||||||  ||| a
3' cccg ugguaccga   cugacaaugg  gcca 
       c         cau          ag     
Get sequence
Deep sequencing
130227 reads, 322 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 75173682-75173747 [+]
sense
OTTMUST00000013960 ; RP23-143A14.3-001; intron 1
ENSMUST00000134252 ; 1700016P03Rik-001; intron 1
ENSMUST00000083603 ; Mir132-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-132
mmu-mir-212chr11: 75173388-75173478 [+]
mmu-mir-132chr11: 75173682-75173747 [+]
Database links

Mature sequence mmu-miR-132-5p

Accession MIMAT0016984
Previous IDsmmu-miR-132*
Sequence

5 - 

aaccguggcuuucgauuguuac

 - 26

Get sequence
Deep sequencing7225 reads, 72 experiments
Evidence experimental; 454 [4], Illumina [5]
Predicted targets

Mature sequence mmu-miR-132-3p

Accession MIMAT0000144
Previous IDsmmu-miR-132
Sequence

42 - 

uaacagucuacagccauggucg

 - 63

Get sequence
Deep sequencing20885 reads, 88 experiments
Evidence experimental; cloned [1-2], Illumina [3,5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).