Stem-loop sequence mmu-mir-130a

Accession MI0000156
Previous IDs mmu-mir-130
Symbol MGI:Mir130a
Description Mus musculus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-ga        c      ug  a  --  - ua 
   gcucuuuu acauug  cu cu  gu c  a
   |||||||| ||||||  || ||  || |   
   cgggaaaa uguaac  ga ga  ca g  c
cua        u      gu  c  gc  u ug 
Get sequence
Deep sequencing
72323 reads, 97 experiments
Comments

This sequence was named miR-130 in reference [1], but is renamed here to avoid confusion with miR-130b (MI0000408 ).

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 84741115-84741178 [-]
intergenic
Database links

Mature sequence mmu-miR-130a-5p

Accession MIMAT0016983
Previous IDs mmu-miR-130a*
Sequence

3 - 

gcucuuuucacauugugcuacu

 - 24

Get sequence
Deep sequencing 393 reads, 41 experiments
Evidence experimental; Solexa [8]
Predicted targets

Mature sequence mmu-miR-130a-3p

Accession MIMAT0000141
Previous IDs mmu-miR-130a
Sequence

42 - 

cagugcaauguuaaaagggcau

 - 63

Get sequence
Deep sequencing 70907 reads, 82 experiments
Evidence experimental; cloned [1-2,4-6], Northern [2], Solexa [7-8]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).