Stem-loop sequence mmu-mir-128-1

AccessionMI0000155
Previous IDsmmu-mir-128;mmu-mir-128a
Symbol MGI:Mir128-1
DescriptionMus musculus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
         uuc       uag      cu       u 
5' guugga   ggggccg   cacugu  gagaggu u
   ||||||   |||||||   ||||||  |||||||  
3' cgacuu   cucuggc   gugaca  cucuuua a
         uuu       caa      --       c 
Get sequence
Deep sequencing
751129 reads, 2.11e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 128202361-128202430 [+]
sense
ENSMUST00000083586 ; Mir128-1-201; exon 1
ENSMUST00000036288 ; R3hdm1-201; intron 19
Database links

Mature sequence mmu-miR-128-1-5p

Accession MIMAT0016982
Previous IDsmmu-miR-128-1*
Sequence

9 - 

cggggccguagcacugucuga

 - 29

Get sequence
Deep sequencing110 reads, 36 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence mmu-miR-128-3p

Accession MIMAT0000140
Previous IDsmmu-miR-128a;mmu-miR-128
Sequence

44 - 

ucacagugaaccggucucuuu

 - 64

Get sequence
Deep sequencing1027768 reads, 88 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).