Stem-loop sequence mmu-mir-127

AccessionMI0000154
Symbol MGI:Mir127
DescriptionMus musculus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-127. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-127 microRNA is a short non-coding RNA molecule with interesting overlapping gene structure. miR-127 functions to regulate the expression levels of genes involved in lung development, placental formation and apoptosis. Aberrant expression of miR-127 has been linked to different cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ----      ugcug         g  c      --  a 
5'     ccagcc     aagcucaga gg ucugau  uc g
       ||||||     ||||||||| || ||||||  || a
3'     ggucgg     uucgagucu cc aggcua  ag a
   ggcu      -----         g  u      cu  a 
Get sequence
Deep sequencing
867105 reads, 4.96e+03 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109592846-109592915 [+]
sense
ENSMUST00000093568 ; Mir127-201; exon 1
antisense
ENSMUST00000149046 ; Rtl1-201; exon 2
Clustered miRNAs
< 10kb from mmu-mir-127
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-127-5p

Accession MIMAT0004530
Previous IDsmmu-miR-127*
Sequence

9 - 

cugaagcucagagggcucugau

 - 30

Get sequence
Deep sequencing49739 reads, 69 experiments
Evidence experimental; cloned [6], Illumina [7-8]
Predicted targets

Mature sequence mmu-miR-127-3p

Accession MIMAT0000139
Previous IDsmmu-miR-127
Sequence

43 - 

ucggauccgucugagcuuggcu

 - 64

Get sequence
Deep sequencing377690 reads, 85 experiments
Evidence experimental; cloned [1,3,5-6], PCR [4], Illumina [7-8]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).