![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-127 |
||||||||||||||||||||||||||||
Accession | MI0000154 (change log) | |||||||||||||||||||||||||||
Symbol | MGI:Mir127 | |||||||||||||||||||||||||||
Description | Mus musculus miR-127 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000080; mir-127 | |||||||||||||||||||||||||||
Literature search |
![]()
64 open access papers mention mmu-mir-127 | |||||||||||||||||||||||||||
Stem-loop |
---- ugcug g c -- a 5' ccagcc aagcucaga gg ucugau uc g |||||| ||||||||| || |||||| || a 3' ggucgg uucgagucu cc aggcua ag a ggcu ----- g u cu a |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6]. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-127-5p |
|
Accession | MIMAT0004530 |
Previous IDs | mmu-miR-127* |
Sequence |
9 - cugaagcucagagggcucugau - 30 |
Deep sequencing | 72899 reads, 87 experiments |
Evidence | experimental; cloned [6], Illumina [7-8] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-127-3p |
|
Accession | MIMAT0000139 |
Previous IDs | mmu-miR-127 |
Sequence |
43 - ucggauccgucugagcuuggcu - 64 |
Deep sequencing | 5584050 reads, 102 experiments |
Evidence | experimental; cloned [1,3,5-6], PCR [4], Illumina [7-8] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 |
PMID:15854907
"RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
Curr Biol. 15:743-749(2005).
|
5 | |
6 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
7 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
8 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|