Stem-loop sequence mmu-mir-127

AccessionMI0000154 (change log)
Symbol MGI:Mir127
DescriptionMus musculus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

64 open access papers mention mmu-mir-127
(602 sentences)

Stem-loop
   ----      ugcug         g  c      --  a 
5'     ccagcc     aagcucaga gg ucugau  uc g
       ||||||     ||||||||| || ||||||  || a
3'     ggucgg     uucgagucu cc aggcua  ag a
   ggcu      -----         g  u      cu  a 
Get sequence
Deep sequencing
5656958 reads, 7.23e+03 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109592846-109592915 [+]
sense
ENSMUST00000093568 ; Mir127-201; exon 1
antisense
ENSMUST00000149046 ; Rtl1-201; exon 2
Clustered miRNAs
< 10kb from mmu-mir-127
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-127-5p

Accession MIMAT0004530
Previous IDsmmu-miR-127*
Sequence

9 - 

cugaagcucagagggcucugau

 - 30

Get sequence
Deep sequencing72899 reads, 87 experiments
Evidence experimental; cloned [6], Illumina [7-8]
Database links
Predicted targets

Mature sequence mmu-miR-127-3p

Accession MIMAT0000139
Previous IDsmmu-miR-127
Sequence

43 - 

ucggauccgucugagcuuggcu

 - 64

Get sequence
Deep sequencing5584050 reads, 102 experiments
Evidence experimental; cloned [1,3,5-6], PCR [4], Illumina [7-8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).