![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-126a |
||||||
Accession | MI0000153 (change log) | |||||
Symbol | MGI:Mir126a | |||||
Description | Mus musculus miR-126a stem-loop | |||||
Gene family | MIPF0000115; mir-126 | |||||
Literature search |
![]()
206 open access papers mention mmu-mir-126a | |||||
Stem-loop |
u a a u c cug c 5' gac gc cauuauuacuu ugguacg g uga a ||| || ||||||||||| ||||||| | ||| 3' cug cg guaauaaugag gccaugc c acu c a g c u u -aa u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
miR-123 identified in [1] was later found to originate from the same precursor as miR-126 and was hence renamed miR-126-5p. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-126a-5p |
|
Accession | MIMAT0000137 |
Sequence |
9 - cauuauuacuuuugguacgcg - 29 |
Deep sequencing | 342783 reads, 97 experiments |
Evidence | experimental; cloned [1-2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-126a-3p |
|
Accession | MIMAT0000138 |
Sequence |
46 - ucguaccgugaguaauaaugcg - 67 |
Deep sequencing | 1771306 reads, 99 experiments |
Evidence | experimental; cloned [1,3-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|