Stem-loop sequence mmu-mir-126a

AccessionMI0000153 (change log)
Symbol MGI:Mir126a
DescriptionMus musculus miR-126a stem-loop
Gene family MIPF0000115; mir-126
Literature search

206 open access papers mention mmu-mir-126a
(1809 sentences)

Stem-loop 
   u   a  a           u       c cug   c 
5'  gac gc cauuauuacuu ugguacg g   uga a
    ||| || ||||||||||| ||||||| |   |||  
3'  cug cg guaauaaugag gccaugc c   acu c
   a   g  c           u       u -aa   u
Get sequence
Deep sequencing
2114293 reads, 5.26e+03 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-123 identified in [1] was later found to originate from the same precursor as miR-126 and was hence renamed miR-126-5p.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 26591357-26591429 [+]
sense
OTTMUST00000027061 ; Egfl7-007; intron 1
OTTMUST00000098442 ; Egfl7-016; intron 1
OTTMUST00000098446 ; RP23-125H15.6-001; intron 3
OTTMUST00000027062 ; Egfl7-008; exon 4
OTTMUST00000027059 ; Egfl7-005; intron 6
OTTMUST00000098440 ; Egfl7-014; intron 6
OTTMUST00000027055 ; Egfl7-001; intron 7
OTTMUST00000027056 ; Egfl7-002; intron 7
OTTMUST00000027057 ; Egfl7-003; intron 7
OTTMUST00000078275 ; Egfl7-011; intron 7
ENSMUST00000131112 ; Egfl7-007; intron 1
ENSMUST00000174656 ; Egfl7-016; intron 1
ENSMUST00000174066 ; Gm20532-001; intron 3
ENSMUST00000147351 ; Egfl7-008; exon 4
ENSMUST00000174211 ; Egfl7-005; intron 6
ENSMUST00000150404 ; Egfl7-014; intron 6
ENSMUST00000166920 ; Egfl7-001; intron 7
ENSMUST00000100290 ; Egfl7-002; intron 7
ENSMUST00000102907 ; Egfl7-003; intron 7
ENSMUST00000139801 ; Egfl7-011; intron 7
Clustered miRNAs
< 10kb from mmu-mir-126a
mmu-mir-126achr2: 26591357-26591429 [+]
mmu-mir-126bchr2: 26591363-26591420 [-]
Database links

Mature sequence mmu-miR-126a-5p

Accession MIMAT0000137
Sequence

9 -  

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing342783 reads, 97 experiments
Evidence experimental; cloned [1-2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-126a-3p

Accession MIMAT0000138
Sequence

46 -  

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing1771306 reads, 99 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).