Stem-loop sequence mmu-mir-126a

AccessionMI0000153
Symbol MGI:Mir126
DescriptionMus musculus miR-126a stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   a  a           u       c cug   c 
5'  gac gc cauuauuacuu ugguacg g   uga a
    ||| || ||||||||||| ||||||| |   |||  
3'  cug cg guaauaaugag gccaugc c   acu c
   a   g  c           u       u -aa   u 
Get sequence
Deep sequencing
530397 reads, 5.4e+03 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-123 identified in [1] was later found to originate from the same precursor as miR-126 and was hence renamed miR-126-5p.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 26591357-26591429 [+]
sense
OTTMUST00000027061 ; Egfl7-007; intron 1
OTTMUST00000098442 ; Egfl7-016; intron 1
OTTMUST00000098446 ; RP23-125H15.6-001; intron 3
OTTMUST00000027062 ; Egfl7-008; exon 4
OTTMUST00000027059 ; Egfl7-005; intron 6
OTTMUST00000098440 ; Egfl7-014; intron 6
OTTMUST00000027055 ; Egfl7-001; intron 7
OTTMUST00000027056 ; Egfl7-002; intron 7
OTTMUST00000027057 ; Egfl7-003; intron 7
OTTMUST00000078275 ; Egfl7-011; intron 7
ENSMUST00000131112 ; Egfl7-007; intron 1
ENSMUST00000174656 ; Egfl7-016; intron 1
ENSMUST00000174066 ; Gm20532-001; intron 3
ENSMUST00000147351 ; Egfl7-008; exon 4
ENSMUST00000174211 ; Egfl7-005; intron 6
ENSMUST00000150404 ; Egfl7-014; intron 6
ENSMUST00000166920 ; Egfl7-001; intron 7
ENSMUST00000100290 ; Egfl7-002; intron 7
ENSMUST00000102907 ; Egfl7-003; intron 7
ENSMUST00000139801 ; Egfl7-011; intron 7
Clustered miRNAs
< 10kb from mmu-mir-126a
mmu-mir-126achr2: 26591357-26591429 [+]
mmu-mir-126bchr2: 26591363-26591420 [-]
Database links

Mature sequence mmu-miR-126a-5p

Accession MIMAT0000137
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing59123 reads, 81 experiments
Evidence experimental; cloned [1-2,4], Illumina [5-6]
Predicted targets

Mature sequence mmu-miR-126a-3p

Accession MIMAT0000138
Sequence

46 - 

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing283845 reads, 85 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).