Stem-loop sequence mmu-mir-125b-2

AccessionMI0000152 (change log)
Previous IDsmmu-mir-125b
Symbol MGI:Mir125b-2
DescriptionMus musculus miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

260 open access papers mention mmu-mir-125b-2
(1492 sentences)

Stem-loop
         uc  ug   c   a        -gg   u 
5' gccuag  cc  aga ccu acuuguga   uau u
   ||||||  ||  ||| ||| ||||||||   |||  
3' cggauc  gg  ucu gga ugaacacu   aug u
         ca  gu   u   c        aca   a 
Get sequence
Deep sequencing
2279045 reads, 1.01e+04 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-125b was cloned from mouse brain tissues in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2] (mir-125b-1, MI0000725; mir-125b-2, MI0000152; the latter was previously named mir-125b here).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 77646273-77646343 [+]
sense
OTTMUST00000113997 ; RP24-252G15.1-013; intron 3
OTTMUST00000113989 ; RP24-252G15.1-003; intron 5
OTTMUST00000113994 ; RP24-252G15.1-006; intron 7
ENSMUST00000183327 ; 2810055G20Rik-013; intron 3
ENSMUST00000183099 ; 2810055G20Rik-003; intron 5
ENSMUST00000182820 ; 2810055G20Rik-006; intron 7
Database links

Mature sequence mmu-miR-125b-5p

Accession MIMAT0000136
Previous IDsmmu-miR-125b
Sequence

7 - 

ucccugagacccuaacuuguga

 - 28

Get sequence
Deep sequencing4485548 reads, 109 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-125b-2-3p

Accession MIMAT0004529
Previous IDsmmu-miR-125b*
Sequence

46 - 

acaagucagguucuugggaccu

 - 67

Get sequence
Deep sequencing60805 reads, 81 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).