Stem-loop sequence mmu-mir-125a

AccessionMI0000151
Symbol MGI:Mir125a
DescriptionMus musculus miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
    ug  uc  ug   c    ua        ----  a 
5' c  gg  cc  aga ccuu  accuguga    gg c
   |  ||  ||  ||| ||||  ||||||||    ||  
3' g  cc  gg  ucu ggag  uggacacu    cc g
    gu  ga  gu   u    --        ggga  u 
Get sequence
Deep sequencing
277114 reads, 1.64e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr17: 17830812-17830879 [+]
sense
OTTMUST00000083961 ; Ncrna00085-003; exon 1
ENSMUST00000133912 ; 4930546H06Rik-003; exon 1
ENSMUST00000083545 ; Mir125a-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-125a
mmu-mir-99bchr17: 17830188-17830257 [+]
mmu-let-7echr17: 17830352-17830444 [+]
mmu-mir-125achr17: 17830812-17830879 [+]
Database links

Mature sequence mmu-miR-125a-5p

Accession MIMAT0000135
Previous IDsmmu-miR-125a
Sequence

6 - 

ucccugagacccuuuaaccuguga

 - 29

Get sequence
Deep sequencing139329 reads, 89 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-125a-3p

Accession MIMAT0004528
Sequence

44 - 

acaggugagguucuugggagcc

 - 65

Get sequence
Deep sequencing2062 reads, 72 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).