Stem-loop sequence mmu-mir-124-3

Accession MI0000150
Previous IDs mmu-mir-124a;mmu-mir-124a-3
Symbol MGI:Mirn124a-3
Description Mus musculus miR-124-3 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However the topic result quite controversial since different reports described also a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    - c        a   ga        uaaug 
cucu g guguucac gcg  ccuugauu     u
|||| | |||||||| |||  ||||||||      
gaga c cguaagug cgc  ggaauuaa     c
    a -        g   ac        cauau 
Get sequence
Deep sequencing
1162886 reads, 74 experiments
Comments

miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MI0000716 ) on chromosome 14, mir-124-2 (MI0000717 ) on chromosome 3, and mir-124-3 (previously known as miR-124a here, MI0000150 ) on chromosome 2. All have closely related predicted human homologues (MI0000443 , MI0000444 and MI0000445 ). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 180894040-180894107 [+]
sense
ENSMUST00000083520 ; Mir124a-3-201; exon 1
Database links

Mature sequence mmu-miR-124-5p

Accession MIMAT0004527
Previous IDs mmu-miR-124*
Sequence

6 - 

cguguucacagcggaccuugau

 - 27

Get sequence
Deep sequencing 4134 reads, 27 experiments
Evidence experimental; cloned [4], Solexa [5-6]
Predicted targets

Mature sequence mmu-miR-124-3p

Accession MIMAT0000134
Previous IDs mmu-miR-124a;mmu-miR-124
Sequence

44 - 

uaaggcacgcggugaaugcc

 - 63

Get sequence
Deep sequencing 1369890 reads, 59 experiments
Evidence experimental; cloned [1-4], Solexa [5-6]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).