Stem-loop sequence mmu-mir-101a

AccessionMI0000148 (change log)
Previous IDsmmu-mir-101
Symbol MGI:Mir101a
DescriptionMus musculus miR-101a stem-loop
Gene family MIPF0000046; mir-101
Literature search

129 open access papers mention mmu-mir-101a
(876 sentences)

Stem-loop
   a       cuggc                  a    gucca 
5'  ggcugcc     ucaguuaucacagugcug ugcu     u
    |||||||     |||||||||||||||||| ||||      
3'  ccgacgg     agucaauagugucaugac augg     u
   a       uagga                  -    aaauc 
Get sequence
Deep sequencing
2607368 reads, 3.98e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 101346945-101347027 [-]
sense
OTTMUST00000019210 ; RP23-32L21.4-001; exon 2
ENSMUST00000144604 ; E130102H24Rik-001; exon 2
Database links

Mature sequence mmu-miR-101a-5p

Accession MIMAT0004526
Previous IDsmmu-miR-101a*
Sequence

14 - 

ucaguuaucacagugcugaugc

 - 35

Get sequence
Deep sequencing2258 reads, 62 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-101a-3p

Accession MIMAT0000133
Previous IDsmmu-miR-101a
Sequence

51 - 

uacaguacugugauaacugaa

 - 71

Get sequence
Deep sequencing2605098 reads, 107 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).