Stem-loop sequence mmu-mir-101a

AccessionMI0000148
Previous IDsmmu-mir-101
Symbol MGI:Mir101a
DescriptionMus musculus miR-101a stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a       cuggc                  a    gucca 
5'  ggcugcc     ucaguuaucacagugcug ugcu     u
    |||||||     |||||||||||||||||| ||||      
3'  ccgacgg     agucaauagugucaugac augg     u
   a       uagga                  -    aaauc 
Get sequence
Deep sequencing
1421156 reads, 4.89e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 101346945-101347027 [-]
sense
OTTMUST00000019210 ; RP23-32L21.4-001; exon 2
ENSMUST00000144604 ; E130102H24Rik-001; exon 2
Database links

Mature sequence mmu-miR-101a-5p

Accession MIMAT0004526
Previous IDsmmu-miR-101a*
Sequence

14 - 

ucaguuaucacagugcugaugc

 - 35

Get sequence
Deep sequencing1351 reads, 41 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Predicted targets

Mature sequence mmu-miR-101a-3p

Accession MIMAT0000133
Previous IDsmmu-miR-101a
Sequence

51 - 

uacaguacugugauaacugaa

 - 71

Get sequence
Deep sequencing307222 reads, 92 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).