|
miRBase |
|
Stem-loop sequence mmu-mir-99b |
||||||||
| Accession | MI0000147 | |||||||
| Symbol | MGI:Mir99b | |||||||
| Description | Mus musculus miR-99b stem-loop | |||||||
| Gene family | MIPF0000025; mir-99 | |||||||
| Stem-loop |
cc ac c c - - c ggcac acccguaga cga cuug g g ggc u ||||| ||||||||| ||| |||| | | ||| cugug ugggugucu gcu gaac c c ccg u cc gu c a a g c |
|||||||
| Deep sequencing |
| |||||||
| Comments |
Expression of this miRNA in mouse was independently verified in the brain [1], embryonic stem cells [2] and testes [3]. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links | ||||||||
Mature sequence mmu-miR-99b-5p |
|
| Accession | MIMAT0000132 |
| Previous IDs | mmu-miR-99b |
| Sequence |
7 - cacccguagaaccgaccuugcg - 28 |
| Deep sequencing | 126959 reads, 82 experiments |
| Evidence | experimental; cloned [1-4], Solexa [5-6] |
| Predicted targets |
|
Mature sequence mmu-miR-99b-3p |
|
| Accession | MIMAT0004525 |
| Previous IDs | mmu-miR-99b* |
| Sequence |
45 - caagcucgugucuguggguccg - 66 |
| Deep sequencing | 4942 reads, 69 experiments |
| Evidence | experimental; cloned [4], Solexa [5-6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
| 2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
| 3 | |
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|