Stem-loop sequence mmu-mir-99b

AccessionMI0000147
Symbol MGI:Mir99b
DescriptionMus musculus miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Deep sequencing
166579 reads, 774 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Expression of this miRNA in mouse was independently verified in the brain [1], embryonic stem cells [2] and testes [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr17: 17830188-17830257 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-99b
mmu-mir-99bchr17: 17830188-17830257 [+]
mmu-let-7echr17: 17830352-17830444 [+]
mmu-mir-125achr17: 17830812-17830879 [+]
Database links

Mature sequence mmu-miR-99b-5p

Accession MIMAT0000132
Previous IDsmmu-miR-99b
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Deep sequencing124912 reads, 92 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Predicted targets

Mature sequence mmu-miR-99b-3p

Accession MIMAT0004525
Previous IDsmmu-miR-99b*
Sequence

45 - 

caagcucgugucuguggguccg

 - 66

Get sequence
Deep sequencing4593 reads, 72 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).