Stem-loop sequence mmu-mir-99a

AccessionMI0000146
Symbol MGI:Mir99a
DescriptionMus musculus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       a         uc   u      g  aag 
5' caua acccguaga  cga cuugug ug   u
   |||| |||||||||  ||| |||||| ||    
3' gugu uggguaucu  gcu gaacgc gc   g
       c         uu   c      -  cag 
Get sequence
Deep sequencing
292914 reads, 2.68e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr16: 77598936-77599000 [+]
sense
OTTMUST00000113997 ; RP24-252G15.1-013; intron 3
OTTMUST00000113989 ; RP24-252G15.1-003; intron 5
OTTMUST00000113994 ; RP24-252G15.1-006; intron 7
ENSMUST00000183327 ; 2810055G20Rik-013; intron 3
ENSMUST00000183099 ; 2810055G20Rik-003; intron 5
ENSMUST00000182820 ; 2810055G20Rik-006; intron 7
antisense
ENSMUST00000114231 ; Gm11146-201; intron 1
Clustered miRNAs
< 10kb from mmu-mir-99a
mmu-mir-99achr16: 77598936-77599000 [+]
mmu-let-7c-1chr16: 77599657-77599750 [+]
Database links

Mature sequence mmu-miR-99a-5p

Accession MIMAT0000131
Previous IDsmmu-miR-99a
Sequence

5 - 

aacccguagauccgaucuugug

 - 26

Get sequence
Deep sequencing153703 reads, 93 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Predicted targets

Mature sequence mmu-miR-99a-3p

Accession MIMAT0016981
Previous IDsmmu-miR-99a*
Sequence

42 - 

caagcucguuucuaugggucu

 - 62

Get sequence
Deep sequencing1130 reads, 52 experiments
Evidence experimental; Illumina [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).