Stem-loop sequence mmu-mir-99a

AccessionMI0000146 (change log)
Symbol MGI:Mir99a
DescriptionMus musculus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Literature search

66 open access papers mention mmu-mir-99a
(756 sentences)

Stem-loop
       a         uc   u      g  aag 
5' caua acccguaga  cga cuugug ug   u
   |||| |||||||||  ||| |||||| ||    
3' gugu uggguaucu  gcu gaacgc gc   g
       c         uu   c      -  cag 
Get sequence
Deep sequencing
2706685 reads, 4.31e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 77598936-77599000 [+]
sense
OTTMUST00000113997 ; RP24-252G15.1-013; intron 3
OTTMUST00000113989 ; RP24-252G15.1-003; intron 5
OTTMUST00000113994 ; RP24-252G15.1-006; intron 7
ENSMUST00000183327 ; 2810055G20Rik-013; intron 3
ENSMUST00000183099 ; 2810055G20Rik-003; intron 5
ENSMUST00000182820 ; 2810055G20Rik-006; intron 7
antisense
ENSMUST00000114231 ; Gm11146-201; intron 1
Clustered miRNAs
< 10kb from mmu-mir-99a
mmu-mir-99achr16: 77598936-77599000 [+]
mmu-let-7c-1chr16: 77599657-77599750 [+]
Database links

Mature sequence mmu-miR-99a-5p

Accession MIMAT0000131
Previous IDsmmu-miR-99a
Sequence

5 - 

aacccguagauccgaucuugug

 - 26

Get sequence
Deep sequencing2701850 reads, 107 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-99a-3p

Accession MIMAT0016981
Previous IDsmmu-miR-99a*
Sequence

42 - 

caagcucguuucuaugggucu

 - 62

Get sequence
Deep sequencing4834 reads, 76 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).