Stem-loop sequence mmu-mir-30b

AccessionMI0000145
Symbol MGI:Mir30b
DescriptionMus musculus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c  ag     uuu     c            u   -        u aua 
5'  ua  ccaag   caguu auguaaacaucc aca cucagcug c   c
    ||  |||||   ||||| |||||||||||| ||| |||||||| |    
3'  au  gguuc   gucga ugcauuuguagg ugu gggucggu g   a
   u  ga     --u     c            -   a        u cgu 
Get sequence
Deep sequencing
147330 reads, 983 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr15: 68337415-68337510 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-30b
mmu-mir-30dchr15: 68341208-68341289 [-]
mmu-mir-30bchr15: 68337415-68337510 [-]
Database links

Mature sequence mmu-miR-30b-5p

Accession MIMAT0000130
Previous IDsmmu-miR-30b
Sequence

21 - 

uguaaacauccuacacucagcu

 - 42

Get sequence
Deep sequencing73695 reads, 92 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-30b-3p

Accession MIMAT0004524
Previous IDsmmu-miR-30b*
Sequence

59 - 

cugggauguggauguuuacguc

 - 80

Get sequence
Deep sequencing13911 reads, 76 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).