Stem-loop sequence mmu-mir-30b

AccessionMI0000145 (change log)
Symbol MGI:Mir30b
DescriptionMus musculus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

209 open access papers mention mmu-mir-30b
(1212 sentences)

Stem-loop
   c  ag     uuu     c            u   -        u aua 
5'  ua  ccaag   caguu auguaaacaucc aca cucagcug c   c
    ||  |||||   ||||| |||||||||||| ||| |||||||| |    
3'  au  gguuc   gucga ugcauuuguagg ugu gggucggu g   a
   u  ga     --u     c            -   a        u cgu 
Get sequence
Deep sequencing
253982 reads, 1.12e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 68337415-68337510 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-30b
mmu-mir-30dchr15: 68341208-68341289 [-]
mmu-mir-30bchr15: 68337415-68337510 [-]
Database links

Mature sequence mmu-miR-30b-5p

Accession MIMAT0000130
Previous IDsmmu-miR-30b
Sequence

21 - 

uguaaacauccuacacucagcu

 - 42

Get sequence
Deep sequencing232920 reads, 107 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-30b-3p

Accession MIMAT0004524
Previous IDsmmu-miR-30b*
Sequence

59 - 

cugggauguggauguuuacguc

 - 80

Get sequence
Deep sequencing20968 reads, 102 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).