Stem-loop sequence mmu-mir-30a

AccessionMI0000144
Symbol MGI:Mir30a
DescriptionMus musculus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      a            uc           -----   a 
5' gcg cuguaaacaucc  gacuggaagcu     gug a
   ||| ||||||||||||  |||||||||||     |||  
3' cgu gacguuuguagg  cugacuuucgg     cac g
      c            --           guaaa   c 
Get sequence
Deep sequencing
3165234 reads, 1.4e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. confirm that the 5' mature miRNA product is the predominant one [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 23272269-23272339 [+]
sense
ENSMUST00000083471 ; Mir30a-201; exon 1
Database links

Mature sequence mmu-miR-30a-5p

Accession MIMAT0000128
Previous IDsmmu-miR-30a-5p;mmu-miR-30a
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing441490 reads, 93 experiments
Evidence experimental; cloned [1-2,4], Illumina [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-30a-3p

Accession MIMAT0000129
Previous IDsmmu-miR-30a-3p;mmu-miR-30a*
Sequence

47 - 

cuuucagucggauguuugcagc

 - 68

Get sequence
Deep sequencing113237 reads, 90 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).