Stem-loop sequence mmu-mir-30a

AccessionMI0000144 (change log)
Symbol MGI:Mir30a
DescriptionMus musculus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

231 open access papers mention mmu-mir-30a
(1521 sentences)

Stem-loop
      a            uc           -----   a 
5' gcg cuguaaacaucc  gacuggaagcu     gug a
   ||| ||||||||||||  |||||||||||     |||  
3' cgu gacguuuguagg  cugacuuucgg     cac g
      c            --           guaaa   c 
Get sequence
Deep sequencing
11649243 reads, 1.41e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. confirm that the 5' mature miRNA product is the predominant one [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 23272269-23272339 [+]
sense
ENSMUST00000083471 ; Mir30a-201; exon 1
Database links

Mature sequence mmu-miR-30a-5p

Accession MIMAT0000128
Previous IDsmmu-miR-30a-5p;mmu-miR-30a
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing10779181 reads, 107 experiments
Evidence experimental; cloned [1-2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-30a-3p

Accession MIMAT0000129
Previous IDsmmu-miR-30a-3p;mmu-miR-30a*
Sequence

47 - 

cuuucagucggauguuugcagc

 - 68

Get sequence
Deep sequencing870055 reads, 106 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).