Stem-loop sequence mmu-mir-29b-1

AccessionMI0000143
Previous IDsmmu-mir-29b
Symbol MGI:Mir29b-1
DescriptionMus musculus miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       a          u      gu      uuaaa 
5' agga gcugguuuca auggug  uuagau     u
   |||| |||||||||| ||||||  ||||||     a
3' ucuu ugacuaaagu uaccac  gaucug     g
       g          u      --      uuagu 
Get sequence
Deep sequencing
411349 reads, 2.21e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr6: 31063023-31063093 [-]
sense
OTTMUST00000114092 ; RP23-459L15.5-001; exon 1
ENSMUST00000083670 ; Mir29b-1-201; exon 1
ENSMUST00000183056 ; Gm27019-001; exon 1
Clustered miRNAs
< 10kb from mmu-mir-29b-1
mmu-mir-29b-1chr6: 31063023-31063093 [-]
mmu-mir-29achr6: 31062660-31062747 [-]
Database links

Mature sequence mmu-miR-29b-1-5p

Accession MIMAT0004523
Previous IDsmmu-miR-29b*;mmu-miR-29b-1*
Sequence

6 - 

gcugguuucauauggugguuua

 - 27

Get sequence
Deep sequencing1577 reads, 68 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Predicted targets

Mature sequence mmu-miR-29b-3p

Accession MIMAT0000127
Previous IDsmmu-miR-29b
Sequence

47 - 

uagcaccauuugaaaucaguguu

 - 69

Get sequence
Deep sequencing417462 reads, 89 experiments
Evidence experimental; cloned [1,3,5], Illumina [6,8]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).