Stem-loop sequence mmu-mir-29b-1

AccessionMI0000143 (change log)
Previous IDsmmu-mir-29b
Symbol MGI:Mir29b-1
DescriptionMus musculus miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

339 open access papers mention mmu-mir-29b-1
(3339 sentences)

Stem-loop
       a          u      gu      uuaaa 
5' agga gcugguuuca auggug  uuagau     u
   |||| |||||||||| ||||||  ||||||     a
3' ucuu ugacuaaagu uaccac  gaucug     g
       g          u      --      uuagu 
Get sequence
Deep sequencing
3450115 reads, 1.39e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 31063023-31063093 [-]
sense
OTTMUST00000114092 ; RP23-459L15.5-001; exon 1
ENSMUST00000083670 ; Mir29b-1-201; exon 1
ENSMUST00000183056 ; Gm27019-001; exon 1
Clustered miRNAs
< 10kb from mmu-mir-29b-1
mmu-mir-29b-1chr6: 31063023-31063093 [-]
mmu-mir-29achr6: 31062660-31062747 [-]
Database links

Mature sequence mmu-miR-29b-1-5p

Accession MIMAT0004523
Previous IDsmmu-miR-29b*;mmu-miR-29b-1*
Sequence

6 - 

gcugguuucauauggugguuua

 - 27

Get sequence
Deep sequencing7987 reads, 96 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-29b-3p

Accession MIMAT0000127
Previous IDsmmu-miR-29b
Sequence

47 - 

uagcaccauuugaaaucaguguu

 - 69

Get sequence
Deep sequencing6885210 reads, 107 experiments
Evidence experimental; cloned [1,3,5], Illumina [6,8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).