Stem-loop sequence mmu-mir-27b

AccessionMI0000142
Symbol MGI:Mir27b
DescriptionMus musculus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
                     auug        ugau     
5' aggugcagagcuuagcug    gugaacag    uggu 
   ||||||||||||||||||    ||||||||    ||| u
3' uccacgucuugaaucggu    cacuuguu    gccu 
                     --ga        --uc     
Get sequence
Deep sequencing
1601454 reads, 8.35e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr13: 63300712-63300784 [+]
sense
OTTMUST00000076332 ; AC130827.2-002; intron 3
ENSMUST00000083541 ; Mir27b-201; exon 1
ENSMUST00000159152 ; 2010111I01Rik-002; intron 3
ENSMUST00000021911 ; 2010111I01Rik-201; intron 15
Clustered miRNAs
< 10kb from mmu-mir-27b
mmu-mir-23bchr13: 63300484-63300557 [+]
mmu-mir-27bchr13: 63300712-63300784 [+]
mmu-mir-3074-1chr13: 63301199-63301283 [-]
mmu-mir-24-1chr13: 63301208-63301275 [+]
Database links

Mature sequence mmu-miR-27b-5p

Accession MIMAT0004522
Previous IDsmmu-miR-27b*
Sequence

7 - 

agagcuuagcugauuggugaac

 - 28

Get sequence
Deep sequencing22439 reads, 86 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Predicted targets

Mature sequence mmu-miR-27b-3p

Accession MIMAT0000126
Previous IDsmmu-miR-27b
Sequence

49 - 

uucacaguggcuaaguucugc

 - 69

Get sequence
Deep sequencing710445 reads, 93 experiments
Evidence experimental; cloned [1,3-5], Illumina [6-7]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).