Stem-loop sequence mmu-mir-27b

AccessionMI0000142 (change log)
Symbol MGI:Mir27b
DescriptionMus musculus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

128 open access papers mention mmu-mir-27b
(560 sentences)

Stem-loop
                     auug        ugau     
5' aggugcagagcuuagcug    gugaacag    uggu 
   ||||||||||||||||||    ||||||||    ||| u
3' uccacgucuugaaucggu    cacuuguu    gccu 
                     --ga        --uc     
Get sequence
Deep sequencing
2406797 reads, 6.66e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 63300712-63300784 [+]
sense
OTTMUST00000076332 ; AC130827.2-002; intron 3
ENSMUST00000083541 ; Mir27b-201; exon 1
ENSMUST00000159152 ; 2010111I01Rik-002; intron 3
ENSMUST00000021911 ; 2010111I01Rik-201; intron 15
Clustered miRNAs
< 10kb from mmu-mir-27b
mmu-mir-23bchr13: 63300484-63300557 [+]
mmu-mir-27bchr13: 63300712-63300784 [+]
mmu-mir-3074-1chr13: 63301199-63301283 [-]
mmu-mir-24-1chr13: 63301208-63301275 [+]
Database links

Mature sequence mmu-miR-27b-5p

Accession MIMAT0004522
Previous IDsmmu-miR-27b*
Sequence

7 - 

agagcuuagcugauuggugaac

 - 28

Get sequence
Deep sequencing34027 reads, 104 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-27b-3p

Accession MIMAT0000126
Previous IDsmmu-miR-27b
Sequence

49 - 

uucacaguggcuaaguucugc

 - 69

Get sequence
Deep sequencing2372712 reads, 107 experiments
Evidence experimental; cloned [1,3-5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).