Stem-loop sequence mmu-mir-23b

AccessionMI0000141
Symbol MGI:Mir23b
DescriptionMus musculus miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
     c   u   --          -  c      gugacu 
5' gg ugc ugg  guuccuggca ug ugauuu      u
   || ||| |||  |||||||||| || ||||||       
3' cc acg acc  uagggaccgu ac acuaaa      g
     a   c   au          u  -      auuaga 
Get sequence
Deep sequencing
873369 reads, 3.6e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr13: 63300484-63300557 [+]
sense
OTTMUST00000076332 ; AC130827.2-002; intron 3
ENSMUST00000083665 ; Mir23b-201; exon 1
ENSMUST00000159152 ; 2010111I01Rik-002; intron 3
ENSMUST00000021911 ; 2010111I01Rik-201; intron 15
Clustered miRNAs
< 10kb from mmu-mir-23b
mmu-mir-23bchr13: 63300484-63300557 [+]
mmu-mir-27bchr13: 63300712-63300784 [+]
mmu-mir-3074-1chr13: 63301199-63301283 [-]
mmu-mir-24-1chr13: 63301208-63301275 [+]
Database links

Mature sequence mmu-miR-23b-5p

Accession MIMAT0016980
Previous IDsmmu-miR-23b*
Sequence

9 - 

ggguuccuggcaugcugauuu

 - 29

Get sequence
Deep sequencing15768 reads, 71 experiments
Evidence experimental; Illumina [6]
Predicted targets

Mature sequence mmu-miR-23b-3p

Accession MIMAT0000125
Previous IDsmmu-miR-23b
Sequence

46 - 

aucacauugccagggauuacc

 - 66

Get sequence
Deep sequencing225346 reads, 90 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).