Stem-loop sequence mmu-mir-15b

AccessionMI0000140 (change log)
Symbol MGI:Mir15b
DescriptionMus musculus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

162 open access papers mention mmu-mir-15b
(824 sentences)

Stem-loop
      u       c  c      ua   a  ac 
5' cug agcagca au augguu  cau cu  a
   ||| ||||||| || ||||||  ||| ||  g
3' gau ucgucgu ua uacuaa  gua ga  u
      c       u  u      gc   -  ac 
Get sequence
Deep sequencing
451054 reads, 2.42e+03 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 69009772-69009835 [+]
sense
OTTMUST00000060029 ; Smc4-001; intron 5
OTTMUST00000060031 ; Smc4-003; intron 5
OTTMUST00000060032 ; Smc4-004; intron 5
OTTMUST00000060030 ; Smc4-002; intron 5
ENSMUST00000083646 ; Mir15b-201; exon 1
ENSMUST00000148385 ; Smc4-002; intron 5
ENSMUST00000107803 ; Smc4-004; intron 5
ENSMUST00000136502 ; Smc4-003; intron 5
ENSMUST00000042901 ; Smc4-001; intron 5
Clustered miRNAs
< 10kb from mmu-mir-15b
mmu-mir-15bchr3: 69009772-69009835 [+]
mmu-mir-16-2chr3: 69009902-69009996 [+]
Database links

Mature sequence mmu-miR-15b-5p

Accession MIMAT0000124
Previous IDsmmu-miR-15b
Sequence

4 - 

uagcagcacaucaugguuuaca

 - 25

Get sequence
Deep sequencing437445 reads, 109 experiments
Evidence experimental; cloned [1-2,4-6], Illumina [7-8]
Database links
Predicted targets

Mature sequence mmu-miR-15b-3p

Accession MIMAT0004521
Previous IDsmmu-miR-15b*
Sequence

42 - 

cgaaucauuauuugcugcucua

 - 63

Get sequence
Deep sequencing12308 reads, 98 experiments
Evidence experimental; cloned [6], Illumina [7-8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).