Stem-loop sequence mmu-let-7i

AccessionMI0000138 (change log)
Previous IDsmmu-let-7iL
Symbol MGI:Mirlet7i
DescriptionMus musculus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

425 open access papers mention mmu-let-7i
(2139 sentences)

Stem-loop
        u                 u   --------  u     ugu 
5' cuggc gagguaguaguuugugc guu        gg cgggu   g
   ||||| ||||||||||||||||| |||        || |||||   a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg   c
        -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
15778735 reads, 3.57e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 122985640-122985724 [-]
sense
ENSMUST00000083472 ; Mirlet7i-201; exon 1
Database links

Mature sequence mmu-let-7i-5p

Accession MIMAT0000122
Previous IDsmmu-let-7i
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing15768604 reads, 107 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-let-7i-3p

Accession MIMAT0004520
Previous IDsmmu-let-7i*
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing10090 reads, 102 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).