Stem-loop sequence mmu-let-7g

AccessionMI0000137
Previous IDsmmu-let-7gL
Symbol MGI:Mirlet7g
DescriptionMus musculus let-7g stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     a   u        a            ugagg    -a  a    a 
5' cc ggc gagguagu guuuguacaguu     gucu  ug uacc c
   || ||| |||||||| ||||||||||||     ||||  || ||||  
3' gg ccg uuccguca cggacaugucaa     uaga  ac augg c
     a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
12541077 reads, 3.93e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence reported in [1] has a 3' terminal A residue, which is incompatible with the reported precursor sequence from [1] and in this entry. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 106178840-106178927 [+]
sense
ENSMUST00000020490 ; Wdr82-201; intron 2
Database links

Mature sequence mmu-let-7g-5p

Accession MIMAT0000121
Previous IDsmmu-let-7g
Sequence

7 - 

ugagguaguaguuuguacaguu

 - 28

Get sequence
Deep sequencing6293771 reads, 91 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Predicted targets

Mature sequence mmu-let-7g-3p

Accession MIMAT0004519
Previous IDsmmu-let-7g*
Sequence

63 - 

acuguacaggccacugccuugc

 - 84

Get sequence
Deep sequencing715 reads, 68 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).