Stem-loop sequence mmu-let-7g

AccessionMI0000137 (change log)
Previous IDsmmu-let-7gL
Symbol MGI:Mirlet7g
DescriptionMus musculus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

414 open access papers mention mmu-let-7g
(2268 sentences)

Stem-loop
     a   u        a            ugagg    -a  a    a 
5' cc ggc gagguagu guuuguacaguu     gucu  ug uacc c
   || ||| |||||||| ||||||||||||     ||||  || ||||  
3' gg ccg uuccguca cggacaugucaa     uaga  ac augg c
     a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
87987434 reads, 1.95e+05 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence reported in [1] has a 3' terminal A residue, which is incompatible with the reported precursor sequence from [1] and in this entry. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 106178840-106178927 [+]
sense
ENSMUST00000020490 ; Wdr82-201; intron 2
Database links

Mature sequence mmu-let-7g-5p

Accession MIMAT0000121
Previous IDsmmu-let-7g
Sequence

7 - 

ugagguaguaguuuguacaguu

 - 28

Get sequence
Deep sequencing87985534 reads, 107 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-let-7g-3p

Accession MIMAT0004519
Previous IDsmmu-let-7g*
Sequence

63 - 

acuguacaggccacugccuugc

 - 84

Get sequence
Deep sequencing1878 reads, 90 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).