Stem-loop sequence dme-mir-14

Accession MI0000136
Description Drosophila melanogaster miR-14 stem-loop
Gene family MIPF0000182; mir-14
Stem-loop 
        c    cg      c     gcu 
ugugggag gaga  gggacu acugu   u
|||||||| ||||  |||||| |||||   a
auauccuc cucu  uucuga ugaua   u
        u    uu      c     aau
Get sequence
Deep sequencing
1990945 reads, 50 experiments
Comments

miR-14 has been reported to act as a cell death repressor and regulator of fat metabolism [2].

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 5441267-5441329 [+]
intergenic
Database links

Mature sequence dme-miR-14-5p

Accession MIMAT0020798
Sequence

4 -  

gggagcgagacggggacucacu

 - 25

Get sequence
Deep sequencing 7077 reads, 48 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-14-3p

Accession MIMAT0000120
Previous IDs dme-miR-14
Sequence

41 -  

ucagucuuuuucucucuccuau

 - 62

Get sequence
Deep sequencing 1983857 reads, 50 experiments
Evidence experimental; cloned [1,4], Northern [3], 454 [5-6], Solexa [6]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:12725740 "The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism" Xu P, Vernooy SY, Guo M, Hay BA Curr Biol. 13:790-795(2003).
3
PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
4
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).