Stem-loop sequence dme-mir-14

AccessionMI0000136 (change log)
DescriptionDrosophila melanogaster miR-14 stem-loop
Gene family MIPF0000182; mir-14
Literature search

24 open access papers mention dme-mir-14
(167 sentences)

Stem-loop
           c    cg      c     gcu 
5' ugugggag gaga  gggacu acugu   u
   |||||||| ||||  |||||| |||||   a
3' auauccuc cucu  uucuga ugaua   u
           u    uu      c     aau 
Get sequence
Deep sequencing
1859507 reads, 5.69e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-14 has been reported to act as a cell death repressor and regulator of fat metabolism [2].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 9553762-9553824 [+]
sense
FBtr0310105 ; CR43651-RB; exon 1
FBtr0310104 ; CR43651-RA; exon 1
Database links

Mature sequence dme-miR-14-5p

Accession MIMAT0020798
Sequence

4 - 

gggagcgagacggggacucacu

 - 25

Get sequence
Deep sequencing297149 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-14-3p

Accession MIMAT0000120
Previous IDsdme-miR-14
Sequence

41 - 

ucagucuuuuucucucuccuau

 - 62

Get sequence
Deep sequencing1562350 reads, 49 experiments
Evidence experimental; cloned [1,4], Northern [3], 454 [5-6], Illumina [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
4
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).