Stem-loop sequence dme-mir-13b-2

AccessionMI0000135 (change log)
DescriptionDrosophila melanogaster miR-13b-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

12 open access papers mention dme-mir-13b-2
(37 sentences)

Stem-loop
   uauu   g          a      gcua      uu 
5'     aac cgucaaaaug cuguga    ugugga  u
       ||| |||||||||| ||||||    ||||||   
3'     uug gcaguuuuac gacacu    auacuu  g
   --gu   a          c      ----      ca 
Get sequence
Deep sequencing
381124 reads, 7.93e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 9091230-9091299 [+]
sense
FBtr0071289 ; CG7033-RA; intron 2
Database links

Mature sequence dme-miR-13b-2-5p

Accession MIMAT0020797
Sequence

8 - 

gcgucaaaaugacugugagcuaug

 - 31

Get sequence
Deep sequencing5522 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-13b-3p

Accession MIMAT0000119
Previous IDsdme-miR-13b
Sequence

46 - 

uaucacagccauuuugacgagu

 - 67

Get sequence
Deep sequencing751302 reads, 49 experiments
Evidence experimental; Northern [1-2], cloned [3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).