Stem-loop sequence dme-mir-13b-1

AccessionMI0000134 (change log)
DescriptionDrosophila melanogaster miR-13b-1 stem-loop
Gene family MIPF0000049; mir-2
Literature search

13 open access papers mention dme-mir-13b-1
(38 sentences)

Stem-loop
      -ug           u      acu    uauu 
5' cca   ucguuaaaaug uuguga   uaug    c
   |||   ||||||||||| ||||||   ||||     
3' ggu   agcaguuuuac gacacu   auac    a
      uug           c      ---    uaac 
Get sequence
Deep sequencing
376236 reads, 7.82e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 15417408-15417475 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-13b-1
dme-mir-2cchr3R: 15417744-15417845 [-]
dme-mir-13achr3R: 15417542-15417616 [-]
dme-mir-13b-1chr3R: 15417408-15417475 [-]
Database links

Mature sequence dme-miR-13b-1-5p

Accession MIMAT0020796
Sequence

6 - 

ucguuaaaauguuugugaacuuaug

 - 30

Get sequence
Deep sequencing535 reads, 40 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-13b-3p

Accession MIMAT0000119
Previous IDsdme-miR-13b
Sequence

43 - 

uaucacagccauuuugacgagu

 - 64

Get sequence
Deep sequencing751302 reads, 49 experiments
Evidence experimental; Northern [1-2], cloned [3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).