Stem-loop sequence dme-mir-13a

AccessionMI0000133 (change log)
DescriptionDrosophila melanogaster miR-13a stem-loop
Gene family MIPF0000049; mir-2
Literature search

12 open access papers mention dme-mir-13a
(25 sentences)

Stem-loop
       u     c      -        a   --uc  cu 
5' uacg aacuc ucaaag gguuguga aug    ga  a
   |||| ||||| |||||| |||||||| |||    ||   
3' gugc uugag aguuuu ccgacacu uac    cu  u
       u     u      a        a   ucau  au 
Get sequence
Deep sequencing
367893 reads, 7.58e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 15417542-15417616 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-13a
dme-mir-2cchr3R: 15417744-15417845 [-]
dme-mir-13achr3R: 15417542-15417616 [-]
dme-mir-13b-1chr3R: 15417408-15417475 [-]
Database links

Mature sequence dme-miR-13a-5p

Accession MIMAT0020795
Sequence

8 - 

cuccucaaaggguugugaaaug

 - 29

Get sequence
Deep sequencing370 reads, 40 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-13a-3p

Accession MIMAT0000118
Previous IDsdme-miR-13a
Sequence

48 - 

uaucacagccauuuugaugagu

 - 69

Get sequence
Deep sequencing367510 reads, 49 experiments
Evidence experimental; cloned [1], Northern [1-2], 454 [3-4], Illumina [4]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).