Stem-loop sequence dme-mir-12

AccessionMI0000132 (change log)
DescriptionDrosophila melanogaster miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

11 open access papers mention dme-mir-12
(35 sentences)

Stem-loop
         ug     u    c          -  gccuu 
5' uacggu  aguau acau agguacuggu gu     a
   ||||||  ||||| |||| |||||||||| ||      
3' gugccg  ucaua ugua uucaugacca ca     a
         ca     c    -          a  accua 
Get sequence
Deep sequencing
2294444 reads, 1.74e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 15509473-15509546 [+]
sense
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074042 ; Gmap-RA; intron 5
Clustered miRNAs
< 10kb from dme-mir-12
dme-mir-283chrX: 15507956-15508055 [+]
dme-mir-304chrX: 15508959-15509046 [+]
dme-mir-12chrX: 15509473-15509546 [+]
Database links

Mature sequence dme-miR-12-5p

Accession MIMAT0000117
Previous IDsdme-miR-12
Sequence

7 - 

ugaguauuacaucagguacuggu

 - 29

Get sequence
Deep sequencing2292938 reads, 49 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature sequence dme-miR-12-3p

Accession MIMAT0020794
Sequence

49 - 

caguacuuaugucauacuacgc

 - 70

Get sequence
Deep sequencing1373 reads, 47 experiments
Evidence not experimental
Database links

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).