Stem-loop sequence dme-mir-12

Accession MI0000132
Description Drosophila melanogaster miR-12 stem-loop
Gene family MIPF0000181; mir-12
Stem-loop 
      ug     u    c          -  gccuu 
uacggu  aguau acau agguacuggu gu     a
||||||  ||||| |||| |||||||||| ||      
gugccg  ucaua ugua uucaugacca ca     a
      ca     c    -          a  accua
Get sequence
Deep sequencing
315277 reads, 50 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
X: 15403506-15403579 [+]
sense
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074043 ; Gmap-RB; intron 4
FBtr0074042 ; Gmap-RA; intron 5
FBtr0074042 ; Gmap-RA; intron 5
FBtr0074042 ; Gmap-RA; intron 5
Clustered miRNAs
< 10kb from dme-mir-12
dme-mir-283 X: 15401989-15402088 [+]
dme-mir-304 X: 15402992-15403079 [+]
dme-mir-12 X: 15403506-15403579 [+]
Database links

Mature sequence dme-miR-12-5p

Accession MIMAT0000117
Previous IDs dme-miR-12
Sequence

7 -  

ugaguauuacaucagguacuggu

 - 29

Get sequence
Deep sequencing 313232 reads, 50 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4-5], Solexa [5]
Predicted targets

Mature sequence dme-miR-12-3p

Accession MIMAT0020794
Sequence

49 -  

caguacuuaugucauacuacgc

 - 70

Get sequence
Deep sequencing 1849 reads, 41 experiments
Evidence not experimental
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).