Stem-loop sequence dme-mir-11

AccessionMI0000131 (change log)
DescriptionDrosophila melanogaster miR-11 stem-loop
Gene family MIPF0000252; mir-11
Literature search

9 open access papers mention dme-mir-11
(54 sentences)

Stem-loop
          u         ucu      ccc   u  acu 
5' gcacuug caagaacuu   cuguga   gcg gu   u
   ||||||| |||||||||   ||||||   ||| ||    
3' cgugagu guucuugag   gacacu   cgc cg   a
          c         ucu      --a   -  aaa 
Get sequence
Deep sequencing
1794768 reads, 1.51e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 21622497-21622571 [-]
sense
FBtr0084118 ; E2f-RC; intron 5
FBtr0084119 ; E2f-RA; intron 5
FBtr0084117 ; E2f-RB; intron 7
Clustered miRNAs
< 10kb from dme-mir-11
dme-mir-11chr3R: 21622497-21622571 [-]
dme-mir-998chr3R: 21621879-21622021 [-]
Database links

Mature sequence dme-miR-11-5p

Accession MIMAT0020793
Sequence

9 - 

caagaacuuucucugugacccg

 - 30

Get sequence
Deep sequencing56468 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-11-3p

Accession MIMAT0000116
Previous IDsdme-miR-11
Sequence

48 - 

caucacagucugaguucuugc

 - 68

Get sequence
Deep sequencing1738283 reads, 49 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).