Stem-loop sequence dme-mir-10

AccessionMI0000130 (change log)
DescriptionDrosophila melanogaster miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

19 open access papers mention dme-mir-10
(147 sentences)

Stem-loop
        ucu   -  g    u             auacu 
5' ccacg   acc cu uaga ccgaauuuguuuu     a
   |||||   ||| || |||| |||||||||||||      
3' ggugu   ugg ga aucu ggcuuaaacagga     g
        guu   a  g    u             auuuc 
Get sequence
Deep sequencing
879179 reads, 6.03e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The first cloning experiments identified the mature miR-10 from the 5' arm of the D. melanogaster precursor [1,3]. High-throughput sequencing later showed that the sequence from the 3' arm dominates [4-5].

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 6809506-6809582 [-]
intergenic
Database links

Mature sequence dme-miR-10-5p

Accession MIMAT0000115
Previous IDsdme-miR-10;dme-miR-10*
Sequence

9 - 

acccuguagauccgaauuuguu

 - 30

Get sequence
Deep sequencing440197 reads, 48 experiments
Evidence experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature sequence dme-miR-10-3p

Accession MIMAT0012531
Previous IDsdme-miR-10
Sequence

49 - 

caaauucgguucuagagagguuu

 - 71

Get sequence
Deep sequencing438977 reads, 48 experiments
Evidence experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).