Stem-loop sequence dme-mir-9a

AccessionMI0000129 (change log)
Previous IDsdme-mir-9
DescriptionDrosophila melanogaster miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

33 open access papers mention dme-mir-9a
(381 sentences)

Stem-loop
       -     u       uau      g     -  gau 
5' gcua uguug cuuuggu   cuagcu uauga gu   a
   |||| ||||| |||||||   |||||| ||||| ||    
3' cgau auaau gaagcca   gaucga auacu ca   a
       u     u       uuc      a     g  aua 
Get sequence
Deep sequencing
723461 reads, 8.51e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 19565131-19565208 [+]
intergenic
Database links

Mature sequence dme-miR-9a-5p

Accession MIMAT0000114
Previous IDsdme-miR-9a
Sequence

10 - 

ucuuugguuaucuagcuguauga

 - 32

Get sequence
Deep sequencing719142 reads, 49 experiments
Evidence experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature sequence dme-miR-9a-3p

Accession MIMAT0020792
Sequence

49 - 

uaaagcuagcuuaccgaaguua

 - 70

Get sequence
Deep sequencing4314 reads, 48 experiments
Evidence not experimental
Database links

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).