Stem-loop sequence dme-mir-8

Accession MI0000128
Description Drosophila melanogaster miR-8 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        cu uu -       -   g     c      uccuu 
aaggacau  g  c acaucuu acc ggcag auuaga     u
||||||||  |  | ||||||| ||| ||||| ||||||     u
uuccugug  c  g uguagaa ugg cuguc uaaucu     u
        -- cu c       a   a     a      caaua 
Get sequence
Deep sequencing
777435 reads, 50 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 12718937-12719023 [+]
intergenic
Database links

Mature sequence dme-miR-8-5p

Accession MIMAT0020791
Sequence

16 - 

caucuuaccgggcagcauuaga

 - 37

Get sequence
Deep sequencing 51857 reads, 50 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-8-3p

Accession MIMAT0000113
Previous IDs dme-miR-8
Sequence

53 - 

uaauacugucagguaaagauguc

 - 75

Get sequence
Deep sequencing 725577 reads, 50 experiments
Evidence experimental; cloned [1,3], Northern [1-3], 454 [4-5], Solexa [5]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).