Stem-loop sequence dme-mir-8

AccessionMI0000128 (change log)
DescriptionDrosophila melanogaster miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

38 open access papers mention dme-mir-8
(294 sentences)

Stem-loop
           cu uu -       -   g     c      uccuu 
5' aaggacau  g  c acaucuu acc ggcag auuaga     u
   ||||||||  |  | ||||||| ||| ||||| ||||||     u
3' uuccugug  c  g uguagaa ugg cuguc uaaucu     u
           -- cu c       a   a     a      caaua 
Get sequence
Deep sequencing
9931617 reads, 5.87e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 16831432-16831518 [+]
sense
FBtr0310102 ; CR43650-RA; exon 1
FBtr0310103 ; CR43650-RB; exon 1
Database links

Mature sequence dme-miR-8-5p

Accession MIMAT0020791
Sequence

16 - 

caucuuaccgggcagcauuaga

 - 37

Get sequence
Deep sequencing221241 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-8-3p

Accession MIMAT0000113
Previous IDsdme-miR-8
Sequence

53 - 

uaauacugucagguaaagauguc

 - 75

Get sequence
Deep sequencing9710375 reads, 49 experiments
Evidence experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).