Stem-loop sequence dme-mir-7

Accession MI0000127
Description Drosophila melanogaster miR-7 stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        u     u       u  u     u      uggu u 
gagugcau ccgua ggaagac ag gauuu guuguu    c u
|||||||| ||||| ||||||| || ||||| ||||||    |  
uuuacgug ggcau ucuucug uc cuaaa uaacaa    g u
        c     -       u  c     -      uaau g 
Get sequence
Deep sequencing
71561 reads, 50 experiments
Comments

Stark et al. [2] have identified targets for miR-7 in Drosophila using computational prediction followed by experimental validation. miR-7 regulates a family of Notch targets including the Enhancer of split and Bearded complex genes Tom and m4, and the basic helix-loop-helix transcriptional repressors HLHm3 and hairy.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 16493572-16493659 [+]
sense
FBtr0086219 ; bl-RB; intron 8
FBtr0086220 ; bl-RA; intron 8
FBtr0301760 ; bl-RE; intron 8
FBtr0086219 ; bl-RB; intron 8
FBtr0086220 ; bl-RA; intron 8
FBtr0301760 ; bl-RE; intron 8
FBtr0086219 ; bl-RB; intron 8
FBtr0086220 ; bl-RA; intron 8
FBtr0301760 ; bl-RE; intron 8
FBtr0086221 ; bl-RC; intron 9
FBtr0086221 ; bl-RC; intron 9
FBtr0086221 ; bl-RC; intron 9
Database links

Mature sequence dme-miR-7-5p

Accession MIMAT0000112
Previous IDs dme-miR-7
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Deep sequencing 67860 reads, 50 experiments
Evidence experimental; cloned [1,4], Northern [1,3-4], 454 [5-6], Solexa [6]
Validated targets
Predicted targets

Mature sequence dme-miR-7-3p

Accession MIMAT0020790
Sequence

55 - 

caauaaaucccuugucuucuua

 - 76

Get sequence
Deep sequencing 3582 reads, 47 experiments
Evidence not experimental
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
3
4
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).