Stem-loop sequence dme-mir-6-3

AccessionMI0000126 (change log)
DescriptionDrosophila melanogaster miR-6-3 stem-loop
Gene family MIPF0000119; mir-6
Literature search

10 open access papers mention dme-mir-6-3
(35 sentences)

Stem-loop
       a             ug   a        u   aaa 
5' caaa agaagggaacggu  cug ugauguag uug   c
   |||| |||||||||||||  ||| |||||||| |||   u
3' guuu uuuuuucuugucg  gac acuauauu aac   c
       g             gu   -        u   acu 
Get sequence
Deep sequencing
24799 reads, 668 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 19660716-19660795 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-6-3
dme-mir-309chr2R: 19661706-19661774 [-]
dme-mir-3chr2R: 19661595-19661663 [-]
dme-mir-286chr2R: 19661422-19661521 [-]
dme-mir-4chr2R: 19661289-19661369 [-]
dme-mir-5chr2R: 19661158-19661226 [-]
dme-mir-6-1chr2R: 19661003-19661084 [-]
dme-mir-6-2chr2R: 19660869-19660942 [-]
dme-mir-6-3chr2R: 19660716-19660795 [-]
Database links

Mature sequence dme-miR-6-3-5p

Accession MIMAT0020789
Sequence

9 - 

agggaacgguugcugaugaugua

 - 31

Get sequence
Deep sequencing5305 reads, 31 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-6-3p

Accession MIMAT0000111
Previous IDsdme-miR-6
Sequence

53 - 

uaucacaguggcuguucuuuuu

 - 74

Get sequence
Deep sequencing57903 reads, 35 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).