Stem-loop sequence dme-mir-6-2

AccessionMI0000125 (change log)
DescriptionDrosophila melanogaster miR-6-2 stem-loop
Gene family MIPF0000119; mir-6
Literature search

8 open access papers mention dme-mir-6-2
(33 sentences)

Stem-loop
        c        uu ug   c       u  -  g 
5' uaacc aagggaac  c  cug ugauaua ua uu a
   ||||| ||||||||  |  ||| ||||||| || ||  
3' guugg uuuucuug  g  gac acuauau au aa a
        u        uc gu   -       c  c  a 
Get sequence
Deep sequencing
22336 reads, 412 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 19660869-19660942 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-6-2
dme-mir-309chr2R: 19661706-19661774 [-]
dme-mir-3chr2R: 19661595-19661663 [-]
dme-mir-286chr2R: 19661422-19661521 [-]
dme-mir-4chr2R: 19661289-19661369 [-]
dme-mir-5chr2R: 19661158-19661226 [-]
dme-mir-6-1chr2R: 19661003-19661084 [-]
dme-mir-6-2chr2R: 19660869-19660942 [-]
dme-mir-6-3chr2R: 19660716-19660795 [-]
Database links

Mature sequence dme-miR-6-2-5p

Accession MIMAT0020788
Sequence

8 - 

agggaacuucugcugcugauaua

 - 30

Get sequence
Deep sequencing3129 reads, 30 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-6-3p

Accession MIMAT0000111
Previous IDsdme-miR-6
Sequence

48 - 

uaucacaguggcuguucuuuuu

 - 69

Get sequence
Deep sequencing57903 reads, 35 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).