|
miRBase |
|
Stem-loop sequence dme-mir-4 |
|||||
| Accession | MI0000122 | ||||
| Description | Drosophila melanogaster miR-4 stem-loop | ||||
| Gene family | MIPF0000305; mir-4 | ||||
| Stem-loop |
ug u gu uu c c cuuag u u caau a uuc uggu guc agc gugauu u | |||| | ||| |||| ||| ||| |||||| u g guug u aag acca cag ucg uacugg c gu c ug uu a a --aaa c |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence dme-miR-4-5p |
|
| Accession | MIMAT0020785 |
| Sequence |
14 - cuuuggucguccagccuuagguga - 37 |
| Deep sequencing | 15344 reads, 25 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence dme-miR-4-3p |
|
| Accession | MIMAT0000109 |
| Previous IDs | dme-miR-4 |
| Sequence |
49 - auaaagcuagacaaccauuga - 69 |
| Deep sequencing | 63095 reads, 40 experiments |
| Evidence | experimental; cloned [1,3], Northern [1-3], 454 [4-5], Solexa [5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
| 2 | |
| 3 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
| 4 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 5 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|