Stem-loop sequence dme-mir-3

AccessionMI0000121 (change log)
DescriptionDrosophila melanogaster miR-3 stem-loop
Gene family MIPF0000140; mir-3
Literature search

6 open access papers mention dme-mir-3
(8 sentences)

Stem-loop
       c         uc    g    u    uuc 
5' gauc ugggaugca  uugu cagu augu   a
   |||| |||||||||  |||| |||| ||||   a
3' cuag acucugugu  aacg guca uaca   u
       a         ga    g    c    cuc 
Get sequence
Deep sequencing
29849 reads, 1.93e+03 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 19661595-19661663 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-3
dme-mir-309chr2R: 19661706-19661774 [-]
dme-mir-3chr2R: 19661595-19661663 [-]
dme-mir-286chr2R: 19661422-19661521 [-]
dme-mir-4chr2R: 19661289-19661369 [-]
dme-mir-5chr2R: 19661158-19661226 [-]
dme-mir-6-1chr2R: 19661003-19661084 [-]
dme-mir-6-2chr2R: 19660869-19660942 [-]
dme-mir-6-3chr2R: 19660716-19660795 [-]
Database links

Mature sequence dme-miR-3-5p

Accession MIMAT0020784
Sequence

8 - 

ggaugcaucuugugcaguuaug

 - 29

Get sequence
Deep sequencing1246 reads, 7 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-3-3p

Accession MIMAT0000108
Previous IDsdme-miR-3
Sequence

43 - 

ucacugggcaaagugugucuca

 - 64

Get sequence
Deep sequencing28603 reads, 45 experiments
Evidence experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).