Stem-loop sequence dme-mir-2b-2

Accession MI0000120
Description Drosophila melanogaster miR-2b-2 stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       a          -         a   --uuu  cuu 
uuguguc uucuucaaag ugguuguga aug     gc   u
||||||| |||||||||| ||||||||| |||     ||    
agcgcag gaggaguuuc accgacacu uac     cg   u
       c          g         a   uuauc  uau 
Get sequence
Deep sequencing
1636945 reads, 50 experiments
Comments

Stark et al. [2] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 19570182-19570264 [-]
sense
FBtr0081272 ; spi-RD; intron 1
FBtr0081270 ; spi-RE; intron 1
FBtr0081267 ; spi-RF; intron 1
FBtr0081270 ; spi-RE; intron 1
FBtr0081267 ; spi-RF; intron 1
FBtr0081270 ; spi-RE; intron 1
FBtr0081267 ; spi-RF; intron 1
FBtr0081271 ; spi-RC; intron 2
FBtr0081269 ; spi-RB; intron 2
FBtr0081268 ; spi-RA; intron 2
FBtr0100597 ; spi-RG; intron 2
FBtr0081269 ; spi-RB; intron 2
FBtr0081268 ; spi-RA; intron 2
FBtr0100597 ; spi-RG; intron 2
FBtr0081269 ; spi-RB; intron 2
FBtr0081268 ; spi-RA; intron 2
FBtr0100597 ; spi-RG; intron 2
Clustered miRNAs
< 10kb from dme-mir-2b-2
dme-mir-2b-2 2L: 19570182-19570264 [-]
dme-mir-2a-1 2L: 19569897-19569972 [-]
dme-mir-2a-2 2L: 19569490-19569561 [-]
Database links

Mature sequence dme-miR-2b-2-5p

Accession MIMAT0020783
Sequence

9 - 

uucuucaaagugguugugaaaug

 - 31

Get sequence
Deep sequencing 19482 reads, 50 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-2b-3p

Accession MIMAT0000107
Previous IDs dme-miR-2b
Sequence

54 - 

uaucacagccagcuuugaggagc

 - 76

Get sequence
Deep sequencing 3097039 reads, 50 experiments
Evidence experimental; cloned [1,4], Northern [1,3], 454 [5-6], Solexa [6]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
3
4
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).