Stem-loop sequence dme-mir-2b-2

AccessionMI0000120 (change log)
DescriptionDrosophila melanogaster miR-2b-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

29 open access papers mention dme-mir-2b-2
(114 sentences)

Stem-loop
          a          -         a   --uuu  cuu 
5' uuguguc uucuucaaag ugguuguga aug     gc   u
   ||||||| |||||||||| ||||||||| |||     ||    
3' agcgcag gaggaguuuc accgacacu uac     cg   u
          c          g         a   uuauc  uau 
Get sequence
Deep sequencing
1246783 reads, 2.21e+04 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Stark et al. [2] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 19570182-19570264 [-]
sense
FBtr0081267 ; spi-RF; intron 1
FBtr0081270 ; spi-RE; intron 1
FBtr0081268 ; spi-RA; intron 2
FBtr0100597 ; spi-RG; intron 2
FBtr0081269 ; spi-RB; intron 2
Clustered miRNAs
< 10kb from dme-mir-2b-2
dme-mir-2b-2chr2L: 19570182-19570264 [-]
dme-mir-2a-1chr2L: 19569897-19569972 [-]
dme-mir-2a-2chr2L: 19569490-19569561 [-]
Database links

Mature sequence dme-miR-2b-2-5p

Accession MIMAT0020783
Sequence

9 - 

uucuucaaagugguugugaaaug

 - 31

Get sequence
Deep sequencing77914 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-2b-3p

Accession MIMAT0000107
Previous IDsdme-miR-2b
Sequence

54 - 

uaucacagccagcuuugaggagc

 - 76

Get sequence
Deep sequencing2265994 reads, 49 experiments
Evidence experimental; cloned [1,4], Northern [1,3], 454 [5-6], Illumina [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
3
4
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).