Stem-loop sequence dme-mir-1

AccessionMI0000116
DescriptionDrosophila melanogaster miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uuca   uuu  --ga            c        a   -   au 
5'     gcc   ga    guuccaugcuuc uugcauuc aua guu  a
       |||   ||    |||||||||||| |||||||| ||| |||  u
3'     cgg   cu    cgagguaugaag aauguaag uau cga  u
   -gag   --u  aaag            a        g   a   ac 
Get sequence
Deep sequencing
570889 reads, 4.03e+04 reads per million, 50 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 20487441-20487531 [+]
intergenic
Database links

Mature sequence dme-miR-1-5p

Accession MIMAT0020779
Sequence

18 - 

ccaugcuuccuugcauucaaua

 - 39

Get sequence
Deep sequencing5654 reads, 39 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-1-3p

Accession MIMAT0000105
Previous IDsdme-miR-1
Sequence

56 - 

uggaauguaaagaaguauggag

 - 77

Get sequence
Deep sequencing470440 reads, 49 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).