Stem-loop sequence dme-mir-1

AccessionMI0000116 (change log)
DescriptionDrosophila melanogaster miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

46 open access papers mention dme-mir-1
(226 sentences)

Stem-loop
   uuca   uuu  --ga            c        a   -   au 
5'     gcc   ga    guuccaugcuuc uugcauuc aua guu  a
       |||   ||    |||||||||||| |||||||| ||| |||  u
3'     cgg   cu    cgagguaugaag aauguaag uau cga  u
   -gag   --u  aaag            a        g   a   ac 
Get sequence
Deep sequencing
21971570 reads, 1.14e+05 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 20487441-20487531 [+]
intergenic
Database links

Mature sequence dme-miR-1-5p

Accession MIMAT0020779
Sequence

18 - 

ccaugcuuccuugcauucaaua

 - 39

Get sequence
Deep sequencing3878 reads, 31 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1-3p

Accession MIMAT0000105
Previous IDsdme-miR-1
Sequence

56 - 

uggaauguaaagaaguauggag

 - 77

Get sequence
Deep sequencing21967687 reads, 49 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).