Stem-loop sequence hsa-mir-16-2

Accession MI0000115
Previous IDs hsa-mir-16-3
Symbol HGNC:MIR16-2
Description Homo sapiens miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  uc    cu         ua        c  ag   aau 
gu  cacu  agcagcacg  aauauugg gu  uga   a
||  ||||  |||||||||  |||||||| ||  |||    
ca  guga  ucgucgugu  uuauaacc ca  auu   u
  gu    uu         ca        a  -a   aua 
Get sequence
Deep sequencing
27927 reads, 54 experiments
Comments

This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MI0000070 ). The sequence was previously named mir-16-3 here and in references [1] and [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 160122533-160122613 [+]
sense
OTTHUMT00000352887 ; SMC4-026; intron 1
OTTHUMT00000352887 ; SMC4-026; intron 1
OTTHUMT00000352887 ; SMC4-026; intron 1
OTTHUMT00000352878 ; SMC4-017; intron 2
OTTHUMT00000352879 ; SMC4-018; intron 2
OTTHUMT00000352878 ; SMC4-017; intron 2
OTTHUMT00000352879 ; SMC4-018; intron 2
OTTHUMT00000352878 ; SMC4-017; intron 2
OTTHUMT00000352879 ; SMC4-018; intron 2
OTTHUMT00000352873 ; SMC4-012; intron 3
OTTHUMT00000352874 ; SMC4-013; intron 3
OTTHUMT00000352865 ; SMC4-004; intron 3
OTTHUMT00000352873 ; SMC4-012; intron 3
OTTHUMT00000352874 ; SMC4-013; intron 3
OTTHUMT00000352865 ; SMC4-004; intron 3
OTTHUMT00000352873 ; SMC4-012; intron 3
OTTHUMT00000352874 ; SMC4-013; intron 3
OTTHUMT00000352865 ; SMC4-004; intron 3
OTTHUMT00000352875 ; SMC4-014; intron 4
OTTHUMT00000352867 ; SMC4-006; intron 4
OTTHUMT00000352868 ; SMC4-007; intron 4
OTTHUMT00000352875 ; SMC4-014; intron 4
OTTHUMT00000352867 ; SMC4-006; intron 4
OTTHUMT00000352868 ; SMC4-007; intron 4
OTTHUMT00000352875 ; SMC4-014; intron 4
OTTHUMT00000352867 ; SMC4-006; intron 4
OTTHUMT00000352868 ; SMC4-007; intron 4
OTTHUMT00000352862 ; SMC4-001; intron 5
OTTHUMT00000352863 ; SMC4-002; intron 5
OTTHUMT00000352864 ; SMC4-003; intron 5
OTTHUMT00000352866 ; SMC4-005; intron 5
OTTHUMT00000352862 ; SMC4-001; intron 5
OTTHUMT00000352863 ; SMC4-002; intron 5
OTTHUMT00000352864 ; SMC4-003; intron 5
OTTHUMT00000352866 ; SMC4-005; intron 5
OTTHUMT00000352862 ; SMC4-001; intron 5
OTTHUMT00000352863 ; SMC4-002; intron 5
OTTHUMT00000352864 ; SMC4-003; intron 5
OTTHUMT00000352866 ; SMC4-005; intron 5
ENST00000487747 ; SMC4-026; intron 1
ENST00000487747 ; SMC4-026; intron 1
ENST00000487747 ; SMC4-026; intron 1
ENST00000470240 ; SMC4-017; intron 2
ENST00000497984 ; SMC4-018; intron 2
ENST00000470240 ; SMC4-017; intron 2
ENST00000497984 ; SMC4-018; intron 2
ENST00000470240 ; SMC4-017; intron 2
ENST00000497984 ; SMC4-018; intron 2
ENST00000472991 ; SMC4-012; intron 3
ENST00000472282 ; SMC4-013; intron 3
ENST00000469858 ; SMC4-004; intron 3
ENST00000472991 ; SMC4-012; intron 3
ENST00000472282 ; SMC4-013; intron 3
ENST00000469858 ; SMC4-004; intron 3
ENST00000472991 ; SMC4-012; intron 3
ENST00000472282 ; SMC4-013; intron 3
ENST00000469858 ; SMC4-004; intron 3
ENST00000467468 ; SMC4-014; intron 4
ENST00000462787 ; SMC4-006; intron 4
ENST00000344722 ; SMC4-007; intron 4
ENST00000467468 ; SMC4-014; intron 4
ENST00000462787 ; SMC4-006; intron 4
ENST00000344722 ; SMC4-007; intron 4
ENST00000467468 ; SMC4-014; intron 4
ENST00000462787 ; SMC4-006; intron 4
ENST00000344722 ; SMC4-007; intron 4
ENST00000357388 ; SMC4-001; intron 5
ENST00000468653 ; SMC4-002; intron 5
ENST00000469762 ; SMC4-003; intron 5
ENST00000489573 ; SMC4-005; intron 5
ENST00000360111 ; SMC4-201; intron 5
ENST00000392788 ; SMC4-202; intron 5
ENST00000357388 ; SMC4-001; intron 5
ENST00000468653 ; SMC4-002; intron 5
ENST00000469762 ; SMC4-003; intron 5
ENST00000489573 ; SMC4-005; intron 5
ENST00000360111 ; SMC4-201; intron 5
ENST00000392788 ; SMC4-202; intron 5
ENST00000357388 ; SMC4-001; intron 5
ENST00000468653 ; SMC4-002; intron 5
ENST00000469762 ; SMC4-003; intron 5
ENST00000489573 ; SMC4-005; intron 5
ENST00000360111 ; SMC4-201; intron 5
antisense
OTTHUMT00000368160 ; RP11-432B6.3-001; intron 3
OTTHUMT00000368160 ; RP11-432B6.3-001; intron 3
OTTHUMT00000368160 ; RP11-432B6.3-001; intron 3
ENST00000483754 ; RP11-432B6.3-001; intron 3
ENST00000483754 ; RP11-432B6.3-001; intron 3
ENST00000483754 ; RP11-432B6.3-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-16-2
hsa-mir-15b chr3: 160122376-160122473 [+]
hsa-mir-16-2 chr3: 160122533-160122613 [+]
Database links

Mature sequence hsa-miR-16-5p

Accession MIMAT0000069
Previous IDs hsa-miR-16
Sequence

10 - 

uagcagcacguaaauauuggcg

 - 31

Get sequence
Deep sequencing 53068 reads, 43 experiments
Evidence experimental; cloned [1,3-4,6-8], Northern [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-16-2-3p

Accession MIMAT0004518
Previous IDs hsa-miR-16-2*
Sequence

53 - 

ccaauauuacugugcugcuuua

 - 74

Get sequence
Deep sequencing 1410 reads, 29 experiments
Evidence experimental; cloned [7]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
6
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).