miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000114

Accession MI0000114
ID hsa-mir-107
Symbol HGNC:MIR107
Description Homo sapiens miR-107 stem-loop
Stem-loop 
c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaa   ucgg ga auguuacgacg aac uug g
-   c      cua    -  c           -   -   a
Get sequence
Comments

This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2].

Genome context
Coordinates (GRCh37) Overlapping transcripts
10: 91352504-91352584 [-]
sense
OTTHUMT00000049318 ; PANK1-002; intron 4
OTTHUMT00000049317 ; PANK1-001; intron 5
ENST00000322191 ; PANK1-002; intron 4
ENST00000342512 ; PANK1-001; intron 5
ENST00000371775 ; PANK1-203; intron 5
ENST00000307534 ; PANK1-201; intron 5
ENST00000371774 ; PANK1-202; intron 6

View flanking features
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0000104

Accession MIMAT0000104
ID hsa-miR-107
Sequence

50 -  

agcagcauuguacagggcuauca

 - 72

Get sequence
Evidence experimental; cloned [2]
Predicted targets

References

1
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).