Stem-loop sequence hsa-mir-107

Accession MI0000114
Previous IDs hsa-mir-107-10
Symbol HGNC:MIR107
Description Homo sapiens miR-107 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaa   ucgg ga auguuacgacg aac uug g
-   c      cua    -  c           -   -   a 
Get sequence
Deep sequencing
850097 reads, 35 experiments
Comments

This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 91352504-91352584 [-]
sense
OTTHUMT00000049318 ; PANK1-002; intron 4
OTTHUMT00000049318 ; PANK1-002; intron 4
OTTHUMT00000049318 ; PANK1-002; intron 4
OTTHUMT00000049317 ; PANK1-001; intron 5
OTTHUMT00000049317 ; PANK1-001; intron 5
OTTHUMT00000049317 ; PANK1-001; intron 5
ENST00000362127 ; MIR107-201; exon 1
ENST00000362127 ; MIR107-201; exon 1
ENST00000362127 ; MIR107-201; exon 1
ENST00000322191 ; PANK1-002; intron 4
ENST00000322191 ; PANK1-002; intron 4
ENST00000322191 ; PANK1-002; intron 4
ENST00000342512 ; PANK1-001; intron 5
ENST00000307534 ; PANK1-201; intron 5
ENST00000342512 ; PANK1-001; intron 5
ENST00000307534 ; PANK1-201; intron 5
ENST00000342512 ; PANK1-001; intron 5
ENST00000307534 ; PANK1-201; intron 5
ENST00000371775 ; PANK1-203; intron 6
ENST00000371774 ; PANK1-202; intron 6
ENST00000371775 ; PANK1-203; intron 6
ENST00000371774 ; PANK1-202; intron 6
ENST00000371774 ; PANK1-202; intron 6
Database links

Mature sequence hsa-miR-107

Accession MIMAT0000104
Sequence

50 - 

agcagcauuguacagggcuauca

 - 72

Get sequence
Deep sequencing 850012 reads, 32 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).