Stem-loop sequence hsa-mir-106a

Accession MI0000113
Previous IDs hsa-mir-106-X;hsa-mir-106
Symbol HGNC:MIR106A
Description Homo sapiens miR-106a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  u   cc      -           g     g   c  u 
cc ugg  auguaa aagugcuuaca ugcag uag uu u
|| |||  |||||| ||||||||||| ||||| ||| || u
gg acc  uacauu uucacgaaugu acguc auc ag g
  u   au      c           a     -   u  a 
Get sequence
Deep sequencing
30122 reads, 36 experiments
Comments

This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MI0000071 ). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MI0000406 and MI0000113 ) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MI0000071 and MI0000687 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 133304228-133304308 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-106a
hsa-mir-106a chrX: 133304228-133304308 [-]
hsa-mir-18b chrX: 133304071-133304141 [-]
hsa-mir-20b chrX: 133303839-133303907 [-]
hsa-mir-19b-2 chrX: 133303701-133303796 [-]
hsa-mir-92a-2 chrX: 133303568-133303642 [-]
hsa-mir-363 chrX: 133303408-133303482 [-]
Database links

Mature sequence hsa-miR-106a-5p

Accession MIMAT0000103
Previous IDs hsa-miR-106a
Sequence

13 - 

aaaagugcuuacagugcagguag

 - 35

Get sequence
Deep sequencing 30045 reads, 36 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-106a-3p

Accession MIMAT0004517
Previous IDs hsa-miR-106a*
Sequence

50 - 

cugcaauguaagcacuucuuac

 - 71

Get sequence
Deep sequencing 77 reads, 8 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).