Stem-loop sequence hsa-mir-106a

AccessionMI0000113
Previous IDshsa-mir-106-X;hsa-mir-106
Symbol HGNC:MIR106A
DescriptionHomo sapiens miR-106a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20a/b, miR-93, and miR-106a/b. With the exception of miR-93, these microRNAs are produced from several microRNA gene clusters, which apparently arose from a series of ancient evolutionary genetic duplication events, and also include members of the miR-19, and miR-25 families. These clusters are transcribed as long non-coding RNA transcripts that are processed to form ~70 nucleotide microRNA precursors, that are subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. The mature microRNA products are thought to regulate expression levels of other genes through complementarity to the 3' UTR of specific target messenger RNA. The paralogous miRNA gene clusters that give rise to miR-17 family microRNAs (miR-17~92, miR-106a~363, and miR-106b~25) have been implicated in a wide variety of malignancies and are sometimes referred to as oncomirs. The oncogenic potential of these non-protein encoding genes was first identified in mouse viral tumorigenesis screens. In humans, the activating mutations of miR-17~92 have been identified in non-Hodgkin's lymphoma, whereas the miRNA constituents of the clusters are overexpressed in a multiple cancer types. High level expression of miR-17 family members induces cell proliferation, whereas deletion of the miR-17~92 cluster, in mice, is lethal and causes lung and lymphoid cell developmental defects.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     u   cc      -           g     g   c  u 
5' cc ugg  auguaa aagugcuuaca ugcag uag uu u
   || |||  |||||| ||||||||||| ||||| ||| || u
3' gg acc  uacauu uucacgaaugu acguc auc ag g
     u   au      c           a     -   u  a 
Get sequence
Deep sequencing
10053 reads, 4.41e+03 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MI0000406 and MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MI0000071 and MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 134170198-134170278 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-106a
hsa-mir-106achrX: 134170198-134170278 [-]
hsa-mir-18bchrX: 134170041-134170111 [-]
hsa-mir-20bchrX: 134169809-134169877 [-]
hsa-mir-19b-2chrX: 134169671-134169766 [-]
hsa-mir-92a-2chrX: 134169538-134169612 [-]
hsa-mir-363chrX: 134169378-134169452 [-]
Database links

Mature sequence hsa-miR-106a-5p

Accession MIMAT0000103
Previous IDshsa-miR-106a
Sequence

13 - 

aaaagugcuuacagugcagguag

 - 35

Get sequence
Deep sequencing1507 reads, 50 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-106a-3p

Accession MIMAT0004517
Previous IDshsa-miR-106a*
Sequence

50 - 

cugcaauguaagcacuucuuac

 - 71

Get sequence
Deep sequencing93 reads, 20 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).