Stem-loop sequence hsa-mir-106a

AccessionMI0000113 (change log)
Previous IDshsa-mir-106-X;hsa-mir-106
Symbol HGNC:MIR106A
DescriptionHomo sapiens miR-106a stem-loop
Gene family MIPF0000001; mir-17
Literature search

256 open access papers mention hsa-mir-106a
(955 sentences)

Stem-loop
     u   cc      -           g     g   c  u 
5' cc ugg  auguaa aagugcuuaca ugcag uag uu u
   || |||  |||||| ||||||||||| ||||| ||| || u
3' gg acc  uacauu uucacgaaugu acguc auc ag g
     u   au      c           a     -   u  a 
Get sequence
Deep sequencing
2193706 reads, 7.94e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MI0000406 and MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MI0000071 and MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 134170198-134170278 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-106a
hsa-mir-106achrX: 134170198-134170278 [-]
hsa-mir-18bchrX: 134170041-134170111 [-]
hsa-mir-20bchrX: 134169809-134169877 [-]
hsa-mir-19b-2chrX: 134169671-134169766 [-]
hsa-mir-92a-2chrX: 134169538-134169612 [-]
hsa-mir-363chrX: 134169378-134169452 [-]
Database links

Mature sequence hsa-miR-106a-5p

Accession MIMAT0000103
Previous IDshsa-miR-106a
Sequence

13 - 

aaaagugcuuacagugcagguag

 - 35

Get sequence
Deep sequencing2188147 reads, 159 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-106a-3p

Accession MIMAT0004517
Previous IDshsa-miR-106a*
Sequence

50 - 

cugcaauguaagcacuucuuac

 - 71

Get sequence
Deep sequencing5556 reads, 110 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).