Stem-loop sequence hsa-mir-105-1

Accession

MI0000111

Previous IDs

hsa-mir-105-X.1

Symbol

HGNC:MIR105-1

Description

Homo sapiens miR-105-1 stem-loop

Gene family

MIPF0000074; mir-105

Stem-loop

ugu         u  a          uc        g ug 
   gcaucgugg ca augcucagac  cuguggug c  c
   ||||||||| || ||||||||||  |||||||| |  u
   uguggcauc gu uacgaguuug  ggcaccac g  c
auc         -  g          ua        - ua 

Deep sequencing

301 reads, 8 experiments

Comments

Mourelatos et al. [1] reported two identical predicted stem loop sequences located on chromosome X, which they named mir-105-X.1 and mir-105-X.2. These sequences have been renamed mir-105-1 (MI0000111 ) and mir-105-2 (MI0000112 ) here. mir-105-2 differs slightly from that published in [1] and deposited in EMBL (EMBL:AF480548). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chrX: 151560691-151560771 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000060921 ; GABRA3-001; intron 1

  OTTHUMT00000060922 ; GABRA3-002; intron 1

  OTTHUMT00000060921 ; GABRA3-001; intron 1

  OTTHUMT00000060922 ; GABRA3-002; intron 1

  OTTHUMT00000060921 ; GABRA3-001; intron 1

  OTTHUMT00000060922 ; GABRA3-002; intron 1

  ENST00000370314 ; GABRA3-001; intron 1

  ENST00000370311 ; GABRA3-002; intron 1

  ENST00000370314 ; GABRA3-001; intron 1

  ENST00000370311 ; GABRA3-002; intron 1

  ENST00000370314 ; GABRA3-001; intron 1

  ENST00000370311 ; GABRA3-002; intron 1

Clustered miRNAs

< 10kb from hsa-mir-105-1

• hsa-mir-105-2: chrX: 151562884-151562964 [-]
• hsa-mir-767: chrX: 151561893-151562001 [-]
• hsa-mir-105-1: chrX: 151560691-151560771 [-]

Database links

• EMBL: AF480503;AF480503
• EMBL: AF480547;AF480547
• ENTREZGENE: 406897;MIR105-1
• HGNC: 31492;MIR105-1

Mature sequence hsa-miR-105-5p

• Accession: MIMAT0000102
• Previous IDs: hsa-miR-105
• Sequence: 13 - ucaaaugcucagacuccuguggu - 35
• Deep sequencing: 276 reads, 7 experiments
• Evidence: experimental; cloned [1-2]
• Validated targets:
  • TARBASE:hsa-miR-105-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-105-5p
  • MICRORNA.ORG:hsa-miR-105-5p
  • MIRDB:hsa-miR-105-5p
  • RNA22-HSA:hsa-miR-105-5p
  • TARGETMINER:hsa-miR-105-5p
  • TARGETSCAN-VERT:hsa-miR-105
  • PICTAR-VERT:hsa-miR-105

Mature sequence hsa-miR-105-3p

• Accession: MIMAT0004516
• Previous IDs: hsa-miR-105*
• Sequence: 51 - acggauguuugagcaugugcua - 72
• Deep sequencing: 326 reads, 6 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-105-3p
  • MICRORNA.ORG:hsa-miR-105-3p
  • MIRDB:hsa-miR-105-3p
  • RNA22-HSA:hsa-miR-105-3p
  • TARGETMINER:hsa-miR-105-3p
  • PICTAR-VERT:hsa-miR-105

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).