|
miRBase |
|
Stem-loop sequence hsa-mir-103a-1 |
||||||
| Accession | MI0000109 | |||||
| Previous IDs | hsa-mir-103-5;hsa-mir-103-1 | |||||
| Symbol | HGNC:MIR103-1 | |||||
| Description | Homo sapiens miR-103a-1 stem-loop | |||||
| Gene family | MIPF0000024; mir-103 | |||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation. |
|||||
| Stem-loop |
uac c -- u u c u g a ugcc uc ggcu cu uacagugcugc uug u c u |||| || |||| || ||||||||||| ||| | | acgg ag ucgg ga auguuacgacg aac a g a guu a ua - c - u g u |
|||||
| Deep sequencing |
| |||||
| Comments |
This sequence was localised to chromosome 5 and named mir-103-5 in reference [1]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence hsa-miR-103a-3p |
|
| Accession | MIMAT0000101 |
| Previous IDs | hsa-miR-103;hsa-miR-103a |
| Sequence |
48 - agcagcauuguacagggcuauga - 70 |
| Deep sequencing | 1706292 reads, 32 experiments |
| Evidence | experimental; cloned [1-4], Northern [2], Solexa [6] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
| 2 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
| 5 | |