Stem-loop sequence hsa-mir-103a-1

AccessionMI0000109 (change log)
Previous IDshsa-mir-103-5;hsa-mir-103-1
Symbol HGNC:MIR103A1
DescriptionHomo sapiens miR-103a-1 stem-loop
Gene family MIPF0000024; mir-103
Literature search

256 open access papers mention hsa-mir-103a-1
(956 sentences)

Stem-loop
   uac    c  --    u  u           c   u g a 
5'    ugcc uc  ggcu cu uacagugcugc uug u c u
      |||| ||  |||| || ||||||||||| ||| | |  
3'    acgg ag  ucgg ga auguuacgacg aac a g a
   guu    a  ua    -  c           -   u g u 
Get sequence
Deep sequencing
5801385 reads, 1.24e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 168560896-168560973 [-]
sense
OTTHUMT00000252792 ; SLIT3-001; intron 4
OTTHUMT00000371504 ; SLIT3-002; intron 4
OTTHUMT00000371505 ; SLIT3-003; intron 4
OTTHUMT00000376173 ; SLIT3-008; intron 4
ENST00000519560 ; SLIT3-001; intron 4
ENST00000332966 ; SLIT3-002; intron 4
ENST00000518140 ; SLIT3-003; intron 4
ENST00000521130 ; SLIT3-008; intron 4
ENST00000404867 ; SLIT3-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-103a-1
hsa-mir-103b-1chr5: 168560904-168560965 [+]
hsa-mir-103a-1chr5: 168560896-168560973 [-]
Database links

Mature sequence hsa-miR-103a-1-5p

Accession MIMAT0037306
Sequence

11 - 

ggcuucuuuacagugcugccuug

 - 33

Get sequence
Deep sequencing2886 reads, 117 experiments
Evidence not experimental

Mature sequence hsa-miR-103a-3p

Accession MIMAT0000101
Previous IDshsa-miR-103;hsa-miR-103a
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing11595735 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [2], Illumina [5]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5