|
miRBase |
|
Stem-loop sequence MI0000109 |
||||||
| Accession | MI0000109 | |||||
| ID | hsa-mir-103-1 | |||||
| Symbol | HGNC:MIR103-1 | |||||
| Description | Homo sapiens miR-103-1 stem-loop | |||||
| Stem-loop |
uac c -- u u c u g a ugcc uc ggcu cu uacagugcugc uug u c u |||| || |||| || ||||||||||| ||| | | acgg ag ucgg ga auguuacgacg aac a g a guu a ua - c - u g u |
|||||
| Comments |
This sequence was localised to chromosome 5 and named mir-103-5 in reference [1]. |
|||||
| Genome context |
View flanking features |
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
| Gene family |
MIPF0000024; mir-103 |
|||||
Mature sequence MIMAT0000101 |
|
| Accession | MIMAT0000101 |
| ID | hsa-miR-103 |
| Sequence |
48 - agcagcauuguacagggcuauga - 70 |
| Evidence | experimental; cloned [1-4], Northern [2], Solexa [5] |
| Predicted targets |
|
References |
|
| 1 |
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
| 2 |
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
| 3 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
| 5 | |