miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000108

Accession MI0000108
ID hsa-mir-103-2
Symbol HGNC:MIR103-2
Description Homo sapiens miR-103-2 stem-loop
Stem-loop
uu  g      --   u  u           ----    ua 
  gu cuuuca  gcu cu uacagugcugc    cuug  g
  || ||||||  ||| || |||||||||||    ||||  c
  ca gaaagu  cgg ga auguuacgacg    ggac  a
ac  a      au   -  c           aacu    uu 
Get sequence
Comments

This sequence was localised to chromosome 20 and named mir-103-20 in reference [1].

Genome context
Coordinates (GRCh37) Overlapping transcripts
20: 3898141-3898218 [+]
sense
OTTHUMT00000077787 ; PANK2-001; intron 5
OTTHUMT00000077788 ; PANK2-002; intron 5
OTTHUMT00000077789 ; PANK2-003; intron 5
OTTHUMT00000077793 ; PANK2-007; intron 5
ENST00000336066 ; PANK2-001; intron 5
ENST00000316562 ; PANK2-007; intron 5
ENST00000361370 ; PANK2-201; intron 5
ENST00000399552 ; PANK2-202; intron 5

View flanking features
Clustered miRNAs
< 10kb from hsa-mir-103-2
hsa-mir-103-2 20: 3898141-3898218 [+]
hsa-mir-103-2-as 20: 3898149-3898210 [-]
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0000101

Accession MIMAT0000101
ID hsa-miR-103
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Evidence experimental; cloned [1-4], Northern [2]
Predicted targets

Minor miR* sequence MIMAT0009196

Accession MIMAT0009196
ID hsa-miR-103-2*
Sequence

11 - 

agcuucuuuacagugcugccuug

 - 33

Get sequence
Evidence experimental; 454 [5]
Predicted targets

References

1
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
"Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
"Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
"Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).