Stem-loop sequence hsa-mir-103a-2

Accession MI0000108
Previous IDs hsa-mir-103-20;hsa-mir-103-2
Symbol HGNC:MIR103-2
Description Homo sapiens miR-103a-2 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uu  g      --   u  u           ----    ua 
  gu cuuuca  gcu cu uacagugcugc    cuug  g
  || ||||||  ||| || |||||||||||    ||||  c
  ca gaaagu  cgg ga auguuacgacg    ggac  a
ac  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
853436 reads, 35 experiments
Comments

This sequence was localised to chromosome 20 and named mir-103-20 in reference [1].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 3898141-3898218 [+]
sense
OTTHUMT00000077787 ; PANK2-001; intron 5
OTTHUMT00000077788 ; PANK2-002; intron 5
OTTHUMT00000077789 ; PANK2-003; intron 5
OTTHUMT00000077793 ; PANK2-007; intron 5
OTTHUMT00000077787 ; PANK2-001; intron 5
OTTHUMT00000077788 ; PANK2-002; intron 5
OTTHUMT00000077789 ; PANK2-003; intron 5
OTTHUMT00000077793 ; PANK2-007; intron 5
OTTHUMT00000077787 ; PANK2-001; intron 5
OTTHUMT00000077788 ; PANK2-002; intron 5
OTTHUMT00000077789 ; PANK2-003; intron 5
OTTHUMT00000077793 ; PANK2-007; intron 5
ENST00000497424 ; PANK2-001; intron 5
ENST00000495692 ; PANK2-003; intron 5
ENST00000316562 ; PANK2-007; intron 5
ENST00000336066 ; PANK2-002; intron 5
ENST00000497424 ; PANK2-001; intron 5
ENST00000495692 ; PANK2-003; intron 5
ENST00000316562 ; PANK2-007; intron 5
ENST00000336066 ; PANK2-002; intron 5
ENST00000497424 ; PANK2-001; intron 5
ENST00000495692 ; PANK2-003; intron 5
ENST00000316562 ; PANK2-007; intron 5
ENST00000336066 ; PANK2-002; intron 5
ENST00000399552 ; PANK2-201; intron 6
ENST00000399552 ; PANK2-201; intron 6
Clustered miRNAs
< 10kb from hsa-mir-103a-2
hsa-mir-103a-2 chr20: 3898141-3898218 [+]
hsa-mir-103b-2 chr20: 3898149-3898210 [-]
Database links

Mature sequence hsa-miR-103a-2-5p

Accession MIMAT0009196
Previous IDs hsa-miR-103-2*;hsa-miR-103a-2*
Sequence

11 - 

agcuucuuuacagugcugccuug

 - 33

Get sequence
Deep sequencing 128 reads, 17 experiments
Evidence experimental; 454 [5]
Predicted targets

Mature sequence hsa-miR-103a-3p

Accession MIMAT0000101
Previous IDs hsa-miR-103;hsa-miR-103a
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing 1706292 reads, 32 experiments
Evidence experimental; cloned [1-4], Northern [2], Solexa [6]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
6