Stem-loop sequence hsa-mir-103a-2

AccessionMI0000108 (change log)
Previous IDshsa-mir-103-20;hsa-mir-103-2
Symbol HGNC:MIR103A2
DescriptionHomo sapiens miR-103a-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

258 open access papers mention hsa-mir-103a-2
(967 sentences)

Stem-loop
   uu  g      --   u  u           ----    ua 
5'   gu cuuuca  gcu cu uacagugcugc    cuug  g
     || ||||||  ||| || |||||||||||    ||||  c
3'   ca gaaagu  cgg ga auguuacgacg    ggac  a
   ac  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
5800617 reads, 1.24e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was localised to chromosome 20 and named mir-103-20 in reference [1].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 3917494-3917571 [+]
antisense
OTTHUMT00000077795 ; RNF24-001; intron 4
OTTHUMT00000252862 ; RNF24-002; intron 4
OTTHUMT00000471914 ; RNF24-003; intron 5
ENST00000336095 ; RNF24-001; intron 4
ENST00000358395 ; RNF24-002; intron 4
ENST00000432261 ; RNF24-201; intron 4
ENST00000545616 ; RNF24-003; intron 5
Clustered miRNAs
< 10kb from hsa-mir-103a-2
hsa-mir-103a-2chr20: 3917494-3917571 [+]
hsa-mir-103b-2chr20: 3917502-3917563 [-]
Database links

Mature sequence hsa-miR-103a-2-5p

Accession MIMAT0009196
Previous IDshsa-miR-103-2*;hsa-miR-103a-2*
Sequence

11 - 

agcuucuuuacagugcugccuug

 - 33

Get sequence
Deep sequencing3370 reads, 132 experiments
Evidence experimental; 454 [5]
Database links
Predicted targets

Mature sequence hsa-miR-103a-3p

Accession MIMAT0000101
Previous IDshsa-miR-103;hsa-miR-103a
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing11595735 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [2], Illumina [5]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
6