Stem-loop sequence hsa-mir-29b-2

AccessionMI0000107 (change log)
Previous IDshsa-mir-102-1;hsa-mir-29b-1
Symbol HGNC:MIR29B2
DescriptionHomo sapiens miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

652 open access papers mention hsa-mir-29b-2
(4257 sentences)

Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Deep sequencing
3108179 reads, 8.56e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MI0000143) and so has been renamed here for consistency.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 207802443-207802523 [-]
antisense
OTTHUMT00000382528 ; CR1-011; intron 13
OTTHUMT00000382524 ; CR1-007; intron 37
OTTHUMT00000088499 ; CR1-002; intron 37
OTTHUMT00000088500 ; CR1-003; intron 37
OTTHUMT00000088335 ; CR1-001; intron 37
OTTHUMT00000382527 ; CR1-012; intron 45
ENST00000529814 ; CR1-011; intron 13
ENST00000367052 ; CR1-007; intron 37
ENST00000367051 ; CR1-002; intron 37
ENST00000367053 ; CR1-003; intron 37
ENST00000400960 ; CR1-001; intron 37
ENST00000367049 ; CR1-012; intron 45
Clustered miRNAs
< 10kb from hsa-mir-29b-2
hsa-mir-29b-2chr1: 207802443-207802523 [-]
hsa-mir-29cchr1: 207801852-207801939 [-]
Database links

Mature sequence hsa-miR-29b-2-5p

Accession MIMAT0004515
Previous IDshsa-miR-29b-2*
Sequence

11 - 

cugguuucacaugguggcuuag

 - 32

Get sequence
Deep sequencing20660 reads, 152 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-29b-3p

Accession MIMAT0000100
Previous IDshsa-miR-29b
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Deep sequencing6175636 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [2]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).