Stem-loop sequence hsa-mir-29b-2

Accession

MI0000107

Previous IDs

hsa-mir-102-1;hsa-mir-29b-1

Symbol

HGNC:MIR29B2

Description

Homo sapiens miR-29b-2 stem-loop

Gene family

MIPF0000009; mir-29

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Stem-loop

         -          c      g  u    uuuucc 
cuucuggaa gcugguuuca auggug cu agau      a
||||||||| |||||||||| |||||| || ||||       
gaggauuuu ugacuaaagu uaccac ga ucua      u
         g          u      -  -    uguuuc 

Deep sequencing

63883 reads, 53 experiments

Comments

This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MI0000143 ) and so has been renamed here for consistency.

Genome context

• Coordinates (GRCh37.p5): chr1: 207975788-207975868 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-29b-2

• hsa-mir-29b-2: chr1: 207975788-207975868 [-]
• hsa-mir-29c: chr1: 207975197-207975284 [-]

Database links

• EMBL: AF480543;AF480543
• ENTREZGENE: 407025;MIR29B2
• HGNC: 31620;MIR29B2
• MIR: MI0000712;mmu-mir-29b-2
• RFAM: RF00074;mir-29

Mature sequence hsa-miR-29b-2-5p

• Accession: MIMAT0004515
• Previous IDs: hsa-miR-29b-2*
• Sequence: 11 - cugguuucacaugguggcuuag - 32
• Deep sequencing: 279 reads, 22 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-29b-2-5p
  • MICRORNA.ORG:hsa-miR-29b-2-5p
  • MIRDB:hsa-miR-29b-2-5p
  • RNA22-HSA:hsa-miR-29b-2-5p
  • TARGETMINER:hsa-miR-29b-2-5p
  • PICTAR-VERT:hsa-miR-29b

Mature sequence hsa-miR-29b-3p

• Accession: MIMAT0000100
• Previous IDs: hsa-miR-29b
• Sequence: 52 - uagcaccauuugaaaucaguguu - 74
• Deep sequencing: 127198 reads, 44 experiments
• Evidence: experimental; cloned [1-4], Northern [2]
• Validated targets:
  • TARBASE:hsa-miR-29b-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-29b-3p
  • MICRORNA.ORG:hsa-miR-29b-3p
  • MIRDB:hsa-miR-29b-3p
  • RNA22-HSA:hsa-miR-29b-3p
  • TARGETMINER:hsa-miR-29b-3p
  • TARGETSCAN-VERT:hsa-miR-29b
  • PICTAR-VERT:hsa-miR-29b

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).